EMAIL THIS PAGE TO A FRIEND

TAS2R45

taste receptor, type 2, member 45

Synonyms: GPR59 T2R45 ZG24P
Species: Human TAS2R45(259291)
UniProtKB ID: P59539
Gene ID:
23 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_176886 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_176886 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_176886 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_176886 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176886 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00369269 predicted 557
2 SASI_Hs01_00089280 predicted 562
3 SASI_Hs02_00369270 predicted 699
4 SASI_Hs02_00369271 predicted 792
5 SASI_Hs02_00369272 predicted 810
6 SASI_Hs02_00369273 predicted 710
7 SASI_Hs02_00369274 predicted 788
8 SASI_Hs01_00089279 predicted 248
9 SASI_Hs01_00089281 predicted 266
10 SASI_Hs01_00089282 predicted 448
11 SASI_Hs01_00089283 predicted 373
12 SASI_Hs01_00089284 predicted 467
13 SASI_Hs01_00089285 predicted 435
14 SASI_Hs01_00089286 predicted 234
15 SASI_Hs01_00089287 predicted 589
16 SASI_Hs01_00089288 predicted 514
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_176886
TAS2R45 MISSION shRNA Bacterial Glycerol Stock
taste receptor, type 2, member 45
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000014098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176886.1-559s1c1
Sequence:CCGGCCCTTTACTGTAACCCTGATACTCGAGTATCAGGGTTACAGTAAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176886.1-715s1c1
Sequence:CCGGGCCATTTACTTTGTGTCTGTACTCGAGTACAGACACAAAGTAAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176886.1-508s1c1
Sequence:CCGGCGTGCAATGTACCTTTCAGATCTCGAGATCTGAAAGGTACATTGCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176886.1-355s1c1
Sequence:CCGGCTTCGCTTAAAGAGGAGAGTTCTCGAGAACTCTCCTCTTTAAGCGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176886.1-166s1c1
Sequence:CCGGGTTGGTTTGCTCTGGGTGTTACTCGAGTAACACCCAGAGCAAACCAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_176886
TAS2R45 MISSION shRNA shRNA Plasmid DNA
taste receptor, type 2, member 45
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000014098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176886.1-559s1c1
Sequence:CCGGCCCTTTACTGTAACCCTGATACTCGAGTATCAGGGTTACAGTAAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176886.1-715s1c1
Sequence:CCGGGCCATTTACTTTGTGTCTGTACTCGAGTACAGACACAAAGTAAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176886.1-508s1c1
Sequence:CCGGCGTGCAATGTACCTTTCAGATCTCGAGATCTGAAAGGTACATTGCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176886.1-355s1c1
Sequence:CCGGCTTCGCTTAAAGAGGAGAGTTCTCGAGAACTCTCCTCTTTAAGCGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176886.1-166s1c1
Sequence:CCGGGTTGGTTTGCTCTGGGTGTTACTCGAGTAACACCCAGAGCAAACCAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_176886
TAS2R45 MISSION shRNA Lentiviral Transduction Particles
taste receptor, type 2, member 45
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000014098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176886.1-559s1c1
Sequence:CCGGCCCTTTACTGTAACCCTGATACTCGAGTATCAGGGTTACAGTAAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176886.1-715s1c1
Sequence:CCGGGCCATTTACTTTGTGTCTGTACTCGAGTACAGACACAAAGTAAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176886.1-508s1c1
Sequence:CCGGCGTGCAATGTACCTTTCAGATCTCGAGATCTGAAAGGTACATTGCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176886.1-355s1c1
Sequence:CCGGCTTCGCTTAAAGAGGAGAGTTCTCGAGAACTCTCCTCTTTAAGCGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176886.1-166s1c1
Sequence:CCGGGTTGGTTTGCTCTGGGTGTTACTCGAGTAACACCCAGAGCAAACCAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks