EMAIL THIS PAGE TO A FRIEND

TAS2R46

taste receptor, type 2, member 46

Synonyms: T2R46 T2R54
UniProtKB ID: P59540, P59548, Q645X6
Gene ID:
Human(259292) Summary: TAS2R46 belongs to the large TAS2R receptor family. TAS2Rs are expressed on the surface of taste receptor cells and mediate the perception of bitterness through a G protein-coupled second messenger pathway (Conte et al., 2002 [PubMed 12584440]
cow(664639) taste receptor, type 2, member 46
cow(782957) taste receptor, type 2, member 46
18 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_176887 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_176887 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_176887 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU226711 MISSION® esiRNA esiRNA targeting human TAS2R46 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_176887 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176887 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00202218 predicted 519
2 SASI_Hs01_00202221 predicted 220
3 SASI_Hs02_00369275 predicted 651
4 SASI_Hs01_00202222 predicted 511
5 SASI_Hs02_00369276 predicted 538
6 SASI_Hs01_00202217 predicted 658
7 SASI_Hs01_00202219 predicted 239
8 SASI_Hs01_00202220 predicted 268
9 SASI_Hs01_00202223 predicted 375
10 SASI_Hs01_00202224 predicted 715
11 SASI_Hs01_00202225 predicted 706
12 SASI_Hs01_00202226 predicted 184
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_176887
TAS2R46 MISSION shRNA Bacterial Glycerol Stock
taste receptor, type 2, member 46
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000014108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176887.1-715s1c1
Sequence:CCGGGCCATTTACTTTCTGTCCATACTCGAGTATGGACAGAAAGTAAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176887.1-518s1c1
Sequence:CCGGACCTTTCAAATACAACGGTAACTCGAGTTACCGTTGTATTTGAAAGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176887.1-250s1c1
Sequence:CCGGGCTTACAATGTCTGGGCAGTACTCGAGTACTGCCCAGACATTGTAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176887.1-702s1c1
Sequence:CCGGCCTCTTGTTATGTGCCATTTACTCGAGTAAATGGCACATAACAAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176887.1-29s1c1
Sequence:CCGGCCATTCTAATAGTGGTTACATCTCGAGATGTAACCACTATTAGAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176887.2-171s21c1
Sequence:CCGGTTTACTCTGGGTATTAGTATTCTCGAGAATACTAATACCCAGAGTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176887.2-728s21c1
Sequence:CCGGTGTCCATAATCATGTCAGTTTCTCGAGAAACTGACATGATTATGGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176887.2-532s21c1
Sequence:CCGGACGGTAACCATCCTAGCAAACCTCGAGGTTTGCTAGGATGGTTACCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_176887
TAS2R46 MISSION shRNA shRNA Plasmid DNA
taste receptor, type 2, member 46
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000014108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176887.1-715s1c1
Sequence:CCGGGCCATTTACTTTCTGTCCATACTCGAGTATGGACAGAAAGTAAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176887.1-518s1c1
Sequence:CCGGACCTTTCAAATACAACGGTAACTCGAGTTACCGTTGTATTTGAAAGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176887.1-250s1c1
Sequence:CCGGGCTTACAATGTCTGGGCAGTACTCGAGTACTGCCCAGACATTGTAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176887.1-702s1c1
Sequence:CCGGCCTCTTGTTATGTGCCATTTACTCGAGTAAATGGCACATAACAAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176887.1-29s1c1
Sequence:CCGGCCATTCTAATAGTGGTTACATCTCGAGATGTAACCACTATTAGAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176887.2-171s21c1
Sequence:CCGGTTTACTCTGGGTATTAGTATTCTCGAGAATACTAATACCCAGAGTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176887.2-728s21c1
Sequence:CCGGTGTCCATAATCATGTCAGTTTCTCGAGAAACTGACATGATTATGGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176887.2-532s21c1
Sequence:CCGGACGGTAACCATCCTAGCAAACCTCGAGGTTTGCTAGGATGGTTACCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_176887
TAS2R46 MISSION shRNA Lentiviral Transduction Particles
taste receptor, type 2, member 46
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000014108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176887.1-715s1c1
Sequence:CCGGGCCATTTACTTTCTGTCCATACTCGAGTATGGACAGAAAGTAAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176887.1-518s1c1
Sequence:CCGGACCTTTCAAATACAACGGTAACTCGAGTTACCGTTGTATTTGAAAGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176887.1-250s1c1
Sequence:CCGGGCTTACAATGTCTGGGCAGTACTCGAGTACTGCCCAGACATTGTAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176887.1-702s1c1
Sequence:CCGGCCTCTTGTTATGTGCCATTTACTCGAGTAAATGGCACATAACAAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176887.1-29s1c1
Sequence:CCGGCCATTCTAATAGTGGTTACATCTCGAGATGTAACCACTATTAGAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176887.2-171s21c1
Sequence:CCGGTTTACTCTGGGTATTAGTATTCTCGAGAATACTAATACCCAGAGTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176887.2-728s21c1
Sequence:CCGGTGTCCATAATCATGTCAGTTTCTCGAGAAACTGACATGATTATGGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176887.2-532s21c1
Sequence:CCGGACGGTAACCATCCTAGCAAACCTCGAGGTTTGCTAGGATGGTTACCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks