EMAIL THIS PAGE TO A FRIEND

TAS2R50

taste receptor, type 2, member 50

Synonyms: T2R50 T2R51 TAS2R51
Species: Human TAS2R50(259296)
UniProtKB ID: P59544, P59545, Q2M255, Q645Y0
Gene ID:
Human(259296) Summary: TAS2R50 belongs to the large TAS2R receptor family. TAS2Rs are expressed on the surface of taste receptor cells and mediate the perception of bitterness through a G protein-coupled second messenger pathway (Conte et al., 2002 [PubMed 12584440]
14 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_176890 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_176890 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_176890 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_176890 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176890 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00032399 predicted 553
2 SASI_Hs01_00032400 predicted 540
3 SASI_Hs01_00032401 predicted 468
4 SASI_Hs01_00032402 predicted 503
5 SASI_Hs01_00032403 predicted 589
6 SASI_Hs01_00032404 predicted 505
7 SASI_Hs01_00032405 predicted 294
8 SASI_Hs01_00032406 predicted 602
9 SASI_Hs02_00369287 predicted 281
10 SASI_Hs02_00369288 predicted 953
11 SASI_Hs01_00032407 predicted 777
12 SASI_Hs01_00032408 predicted 77
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_176890
TAS2R50 MISSION shRNA Bacterial Glycerol Stock
taste receptor, type 2, member 50
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000063353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176890.1-448s1c1
Sequence:CCGGGATGAGAGTATGTGGGCAGAACTCGAGTTCTGCCCACATACTCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176890.1-503s1c1
Sequence:CCGGTGAGGAATACAGTACATCTTTCTCGAGAAAGATGTACTGTATTCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176890.1-727s1c1
Sequence:CCGGCTATTCCTAATCGTTTCGGTTCTCGAGAACCGAAACGATTAGGAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176890.1-260s1c1
Sequence:CCGGCCTGGGTTGTAACCAACCATTCTCGAGAATGGTTGGTTACAACCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176890.1-543s1c1
Sequence:CCGGCCTATGGAGCTTCATACCCTTCTCGAGAAGGGTATGAAGCTCCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176890.2-635s21c1
Sequence:CCGGTTTCTGATGCTAATCTGTTCTCTCGAGAGAACAGATTAGCATCAGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176890.2-476s21c1
Sequence:CCGGTGTCATCTTCTTGTGGCAAACCTCGAGGTTTGCCACAAGAAGATGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176890.2-99s21c1
Sequence:CCGGTATTTGTTCTCGGAAACTTTGCTCGAGCAAAGTTTCCGAGAACAAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_176890
TAS2R50 MISSION shRNA shRNA Plasmid DNA
taste receptor, type 2, member 50
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000063353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176890.1-448s1c1
Sequence:CCGGGATGAGAGTATGTGGGCAGAACTCGAGTTCTGCCCACATACTCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176890.1-503s1c1
Sequence:CCGGTGAGGAATACAGTACATCTTTCTCGAGAAAGATGTACTGTATTCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176890.1-727s1c1
Sequence:CCGGCTATTCCTAATCGTTTCGGTTCTCGAGAACCGAAACGATTAGGAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176890.1-260s1c1
Sequence:CCGGCCTGGGTTGTAACCAACCATTCTCGAGAATGGTTGGTTACAACCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176890.1-543s1c1
Sequence:CCGGCCTATGGAGCTTCATACCCTTCTCGAGAAGGGTATGAAGCTCCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176890.2-635s21c1
Sequence:CCGGTTTCTGATGCTAATCTGTTCTCTCGAGAGAACAGATTAGCATCAGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176890.2-476s21c1
Sequence:CCGGTGTCATCTTCTTGTGGCAAACCTCGAGGTTTGCCACAAGAAGATGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176890.2-99s21c1
Sequence:CCGGTATTTGTTCTCGGAAACTTTGCTCGAGCAAAGTTTCCGAGAACAAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_176890
TAS2R50 MISSION shRNA Lentiviral Transduction Particles
taste receptor, type 2, member 50
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000063353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176890.1-448s1c1
Sequence:CCGGGATGAGAGTATGTGGGCAGAACTCGAGTTCTGCCCACATACTCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176890.1-503s1c1
Sequence:CCGGTGAGGAATACAGTACATCTTTCTCGAGAAAGATGTACTGTATTCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176890.1-727s1c1
Sequence:CCGGCTATTCCTAATCGTTTCGGTTCTCGAGAACCGAAACGATTAGGAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176890.1-260s1c1
Sequence:CCGGCCTGGGTTGTAACCAACCATTCTCGAGAATGGTTGGTTACAACCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176890.1-543s1c1
Sequence:CCGGCCTATGGAGCTTCATACCCTTCTCGAGAAGGGTATGAAGCTCCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176890.2-635s21c1
Sequence:CCGGTTTCTGATGCTAATCTGTTCTCTCGAGAGAACAGATTAGCATCAGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176890.2-476s21c1
Sequence:CCGGTGTCATCTTCTTGTGGCAAACCTCGAGGTTTGCCACAAGAAGATGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176890.2-99s21c1
Sequence:CCGGTATTTGTTCTCGGAAACTTTGCTCGAGCAAAGTTTCCGAGAACAAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks