EMAIL THIS PAGE TO A FRIEND

TAS2R5

taste receptor, type 2, member 5

Synonyms: T2R5
UniProtKB ID: Q9NYW4, Q645W0, Q75MV7
Gene ID:
Human(54429) Summary: This gene encodes a bitter taste receptor; bitter taste receptors are members of the G protein-coupled receptor superfamily and are specifically expressed by taste receptor cells of the tongue and palate epithelia. Each of these apparently intronless taste receptor genes encodes a 7-transmembrane receptor protein, functioning as a bitter taste receptor. This gene is clustered with another 3 candidate taste receptor genes on chromosome 7 and is genetically linked to loci that influence bitter perception. [provided by RefSeq, Jul 2008]
dog(100271743) taste receptor, type 2, member 5
17 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018980 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018980 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018980 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU144911 MISSION® esiRNA esiRNA human TAS2R5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018980 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018980 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00213444 predicted 644
2 SASI_Hs01_00213445 predicted 820
3 SASI_Hs01_00213446 predicted 562
4 SASI_Hs02_00352477 predicted 610
5 SASI_Hs01_00213447 predicted 659
6 SASI_Hs01_00213448 predicted 820
7 SASI_Hs01_00213449 predicted 669
8 SASI_Hs01_00213450 predicted 639
9 SASI_Hs01_00213451 predicted 507
10 SASI_Hs01_00213452 predicted 674
11 SASI_Hs01_00213443 predicted 719
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018980
TAS2R5 MISSION shRNA Bacterial Glycerol Stock
taste receptor, type 2, member 5
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000358209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018980.2-190s21c1
Sequence:CCGGTGAATTTCTCATCGGTTTAATCTCGAGATTAAACCGATGAGAAATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018980.2-315s21c1
Sequence:CCGGTCCTGCAGTGGCTGATCATTTCTCGAGAAATGATCAGCCACTGCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018980.2-557s21c1
Sequence:CCGGTTGTTACTTACAGTCCAAATTCTCGAGAATTTGGACTGTAAGTAACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018980.1-52s1c1
Sequence:CCGGCTCATCGGTTTAATTGGAAATCTCGAGATTTCCAATTAAACCGATGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018980.1-516s1c1
Sequence:CCGGGCTCAATTCAGGAAGTTATTTCTCGAGAAATAACTTCCTGAATTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018980.1-123s1c1
Sequence:CCGGGTCCTCATATAACCTCATTATCTCGAGATAATGAGGTTATATGAGGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018980.1-231s1c1
Sequence:CCGGGCTTCGCTATCTTAGTATCTTCTCGAGAAGATACTAAGATAGCGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018980
TAS2R5 MISSION shRNA shRNA Plasmid DNA
taste receptor, type 2, member 5
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000358209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018980.2-190s21c1
Sequence:CCGGTGAATTTCTCATCGGTTTAATCTCGAGATTAAACCGATGAGAAATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018980.2-315s21c1
Sequence:CCGGTCCTGCAGTGGCTGATCATTTCTCGAGAAATGATCAGCCACTGCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018980.2-557s21c1
Sequence:CCGGTTGTTACTTACAGTCCAAATTCTCGAGAATTTGGACTGTAAGTAACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018980.1-52s1c1
Sequence:CCGGCTCATCGGTTTAATTGGAAATCTCGAGATTTCCAATTAAACCGATGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018980.1-516s1c1
Sequence:CCGGGCTCAATTCAGGAAGTTATTTCTCGAGAAATAACTTCCTGAATTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018980.1-123s1c1
Sequence:CCGGGTCCTCATATAACCTCATTATCTCGAGATAATGAGGTTATATGAGGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018980.1-231s1c1
Sequence:CCGGGCTTCGCTATCTTAGTATCTTCTCGAGAAGATACTAAGATAGCGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018980
TAS2R5 MISSION shRNA Lentiviral Transduction Particles
taste receptor, type 2, member 5
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000358209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018980.2-190s21c1
Sequence:CCGGTGAATTTCTCATCGGTTTAATCTCGAGATTAAACCGATGAGAAATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018980.2-315s21c1
Sequence:CCGGTCCTGCAGTGGCTGATCATTTCTCGAGAAATGATCAGCCACTGCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018980.2-557s21c1
Sequence:CCGGTTGTTACTTACAGTCCAAATTCTCGAGAATTTGGACTGTAAGTAACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018980.1-52s1c1
Sequence:CCGGCTCATCGGTTTAATTGGAAATCTCGAGATTTCCAATTAAACCGATGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018980.1-516s1c1
Sequence:CCGGGCTCAATTCAGGAAGTTATTTCTCGAGAAATAACTTCCTGAATTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018980.1-123s1c1
Sequence:CCGGGTCCTCATATAACCTCATTATCTCGAGATAATGAGGTTATATGAGGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018980.1-231s1c1
Sequence:CCGGGCTTCGCTATCTTAGTATCTTCTCGAGAAGATACTAAGATAGCGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks