EMAIL THIS PAGE TO A FRIEND

TAS2R60

taste receptor, type 2, member 60

Synonyms: T2R56 T2R60
UniProtKB ID: P59551, A4D2G8, Q645W8, Q7RTR7
Gene ID:
cow(785676) taste receptor, type 2, member 60
20 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177437 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_177437 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_177437 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU120751 MISSION® esiRNA esiRNA human TAS2R60 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_177437 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177437 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00082376 predicted 678
2 SASI_Hs01_00082377 predicted 480
3 SASI_Hs01_00082378 predicted 518
4 SASI_Hs01_00082379 predicted 208
5 SASI_Hs01_00082380 predicted 381
6 SASI_Hs01_00082381 predicted 338
7 SASI_Hs01_00082382 predicted 563
8 SASI_Hs01_00082383 predicted 216
9 SASI_Hs01_00082384 predicted 706
10 SASI_Hs01_00082385 predicted 542
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177437
TAS2R60 MISSION shRNA Bacterial Glycerol Stock
taste receptor, type 2, member 60
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000368555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177437.1-155s21c1
Sequence:CCGGTGTTGCCTTGTGATAAGTTATCTCGAGATAACTTATCACAAGGCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177437.1-759s21c1
Sequence:CCGGCATGCTCTTCATCTCATATTTCTCGAGAAATATGAGATGAAGAGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177437.1-554s21c1
Sequence:CCGGTACGGAGCTACTGTGAGAAATCTCGAGATTTCTCACAGTAGCTCCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177437.1-50s21c1
Sequence:CCGGCCATCATCTTGGTTACCATTTCTCGAGAAATGGTAACCAAGATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177437.1-758s1c1
Sequence:CCGGCCATGCTCTTCATCTCATATTCTCGAGAATATGAGATGAAGAGCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177437.1-681s1c1
Sequence:CCGGTCTCCTTACAACCTCAGGATTCTCGAGAATCCTGAGGTTGTAAGGAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177437.1-564s1c1
Sequence:CCGGCTGTGAGAAATTCTATCTCTTCTCGAGAAGAGATAGAATTTCTCACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177437.1-166s1c1
Sequence:CCGGGATAAGTTATTGGTTAGCCTACTCGAGTAGGCTAACCAATAACTTATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177437.1-49s1c1
Sequence:CCGGGCCATCATCTTGGTTACCATTCTCGAGAATGGTAACCAAGATGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177437
TAS2R60 MISSION shRNA shRNA Plasmid DNA
taste receptor, type 2, member 60
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000368555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177437.1-155s21c1
Sequence:CCGGTGTTGCCTTGTGATAAGTTATCTCGAGATAACTTATCACAAGGCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177437.1-759s21c1
Sequence:CCGGCATGCTCTTCATCTCATATTTCTCGAGAAATATGAGATGAAGAGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177437.1-554s21c1
Sequence:CCGGTACGGAGCTACTGTGAGAAATCTCGAGATTTCTCACAGTAGCTCCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177437.1-50s21c1
Sequence:CCGGCCATCATCTTGGTTACCATTTCTCGAGAAATGGTAACCAAGATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177437.1-758s1c1
Sequence:CCGGCCATGCTCTTCATCTCATATTCTCGAGAATATGAGATGAAGAGCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177437.1-681s1c1
Sequence:CCGGTCTCCTTACAACCTCAGGATTCTCGAGAATCCTGAGGTTGTAAGGAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177437.1-564s1c1
Sequence:CCGGCTGTGAGAAATTCTATCTCTTCTCGAGAAGAGATAGAATTTCTCACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177437.1-166s1c1
Sequence:CCGGGATAAGTTATTGGTTAGCCTACTCGAGTAGGCTAACCAATAACTTATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177437.1-49s1c1
Sequence:CCGGGCCATCATCTTGGTTACCATTCTCGAGAATGGTAACCAAGATGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177437
TAS2R60 MISSION shRNA Lentiviral Transduction Particles
taste receptor, type 2, member 60
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000368555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177437.1-155s21c1
Sequence:CCGGTGTTGCCTTGTGATAAGTTATCTCGAGATAACTTATCACAAGGCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177437.1-759s21c1
Sequence:CCGGCATGCTCTTCATCTCATATTTCTCGAGAAATATGAGATGAAGAGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177437.1-554s21c1
Sequence:CCGGTACGGAGCTACTGTGAGAAATCTCGAGATTTCTCACAGTAGCTCCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177437.1-50s21c1
Sequence:CCGGCCATCATCTTGGTTACCATTTCTCGAGAAATGGTAACCAAGATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177437.1-758s1c1
Sequence:CCGGCCATGCTCTTCATCTCATATTCTCGAGAATATGAGATGAAGAGCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177437.1-681s1c1
Sequence:CCGGTCTCCTTACAACCTCAGGATTCTCGAGAATCCTGAGGTTGTAAGGAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177437.1-564s1c1
Sequence:CCGGCTGTGAGAAATTCTATCTCTTCTCGAGAAGAGATAGAATTTCTCACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177437.1-166s1c1
Sequence:CCGGGATAAGTTATTGGTTAGCCTACTCGAGTAGGCTAACCAATAACTTATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177437.1-49s1c1
Sequence:CCGGGCCATCATCTTGGTTACCATTCTCGAGAATGGTAACCAAGATGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks