EMAIL THIS PAGE TO A FRIEND

TAS2R8

taste receptor, type 2, member 8

Synonyms: T2R8 TRB5
UniProtKB ID: Q9NYW2, Q4KN29, Q645Y2
Gene ID:
Human(50836) Summary: This gene product belongs to the family of candidate taste receptors that are members of the G-protein-coupled receptor superfamily. These proteins are specifically expressed in the taste receptor cells of the tongue and palate epithelia. They are organized in the genome in clusters and are genetically linked to loci that influence bitter perception in mice and humans. In functional expression studies, they respond to bitter tastants. This gene maps to the taste receptor gene cluster on chromosome 12p13. [provided by RefSeq, Jul 2008]
dog(100682910) taste receptor, type 2, member 8
20 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4502085 Anti-TAS2R8 antibody produced in rabbit affinity isolated antibody human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023918 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_023918 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_023918 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_023918 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023918 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00212112 predicted 262
2 SASI_Hs01_00212113 predicted 298
3 SASI_Hs02_00356370 predicted 262
4 SASI_Hs01_00212115 predicted 426
5 SASI_Hs01_00212116 predicted 412
6 SASI_Hs01_00212117 predicted 500
7 SASI_Hs01_00212119 predicted 459
8 SASI_Hs02_00356371 predicted 396
9 SASI_Hs01_00212120 predicted 444
10 SASI_Hs02_00356372 predicted 435
11 SASI_Hs01_00212111 predicted 403
12 SASI_Hs01_00212114 predicted 288
13 SASI_Hs01_00212118 predicted 204
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023918
TAS2R8 MISSION shRNA Bacterial Glycerol Stock
taste receptor, type 2, member 8
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023918.1-207s21c1
Sequence:CCGGAGTACTGAACCCAGATGTTTACTCGAGTAAACATCTGGGTTCAGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023918.1-90s21c1
Sequence:CCGGCAACTGGATTGACTGGATTAACTCGAGTTAATCCAGTCAATCCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023918.1-267s21c1
Sequence:CCGGGACATTTGCCAACTACTTAAACTCGAGTTTAAGTAGTTGGCAAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023918.1-577s1c1
Sequence:CCGGCCATTTATTGTGTCACTGATACTCGAGTATCAGTGACACAATAAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023918.1-125s1c1
Sequence:CCGGCCACAGTTGACTACATCCTTACTCGAGTAAGGATGTAGTCAACTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023918.1-146s1c1
Sequence:CCGGCCAATTTAGTTATCGCCAGAACTCGAGTTCTGGCGATAACTAAATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023918.1-764s1c1
Sequence:CCGGCCTTTAGCTATCTTATGACAACTCGAGTTGTCATAAGATAGCTAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023918.1-302s1c1
Sequence:CCGGCCTGCCTTAATGTCTTCTATTCTCGAGAATAGAAGACATTAAGGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023918
TAS2R8 MISSION shRNA shRNA Plasmid DNA
taste receptor, type 2, member 8
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023918.1-207s21c1
Sequence:CCGGAGTACTGAACCCAGATGTTTACTCGAGTAAACATCTGGGTTCAGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023918.1-90s21c1
Sequence:CCGGCAACTGGATTGACTGGATTAACTCGAGTTAATCCAGTCAATCCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023918.1-267s21c1
Sequence:CCGGGACATTTGCCAACTACTTAAACTCGAGTTTAAGTAGTTGGCAAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023918.1-577s1c1
Sequence:CCGGCCATTTATTGTGTCACTGATACTCGAGTATCAGTGACACAATAAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023918.1-125s1c1
Sequence:CCGGCCACAGTTGACTACATCCTTACTCGAGTAAGGATGTAGTCAACTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023918.1-146s1c1
Sequence:CCGGCCAATTTAGTTATCGCCAGAACTCGAGTTCTGGCGATAACTAAATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023918.1-764s1c1
Sequence:CCGGCCTTTAGCTATCTTATGACAACTCGAGTTGTCATAAGATAGCTAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023918.1-302s1c1
Sequence:CCGGCCTGCCTTAATGTCTTCTATTCTCGAGAATAGAAGACATTAAGGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023918
TAS2R8 MISSION shRNA Lentiviral Transduction Particles
taste receptor, type 2, member 8
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023918.1-207s21c1
Sequence:CCGGAGTACTGAACCCAGATGTTTACTCGAGTAAACATCTGGGTTCAGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023918.1-90s21c1
Sequence:CCGGCAACTGGATTGACTGGATTAACTCGAGTTAATCCAGTCAATCCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023918.1-267s21c1
Sequence:CCGGGACATTTGCCAACTACTTAAACTCGAGTTTAAGTAGTTGGCAAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023918.1-577s1c1
Sequence:CCGGCCATTTATTGTGTCACTGATACTCGAGTATCAGTGACACAATAAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023918.1-125s1c1
Sequence:CCGGCCACAGTTGACTACATCCTTACTCGAGTAAGGATGTAGTCAACTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023918.1-146s1c1
Sequence:CCGGCCAATTTAGTTATCGCCAGAACTCGAGTTCTGGCGATAACTAAATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023918.1-764s1c1
Sequence:CCGGCCTTTAGCTATCTTATGACAACTCGAGTTGTCATAAGATAGCTAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023918.1-302s1c1
Sequence:CCGGCCTGCCTTAATGTCTTCTATTCTCGAGAATAGAAGACATTAAGGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks