EMAIL THIS PAGE TO A FRIEND

TAS2R9

taste receptor, type 2, member 9

Synonyms: T2R9 TRB6
UniProtKB ID: Q9NYW1, Q502V7, Q50KT0, Q50KT1, Q645W9
Gene ID:
Human(50835) Summary: This gene product belongs to the family of candidate taste receptors that are members of the G-protein-coupled receptor superfamily. These proteins are specifically expressed in the taste receptor cells of the tongue and palate epithelia. They are organized in the genome in clusters and are genetically linked to loci that influence bitter perception in mice and humans. In functional expression studies, they respond to bitter tastants. This gene maps to the taste receptor gene cluster on chromosome 12p13. [provided by RefSeq, Jul 2008]
dog(100686911) taste receptor, type 2, member 9
cow(784559) taste receptor type 2 member 9-like
20 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302455 ANTI-TAS2R9 (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023917 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_023917 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_023917 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_023917 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023917 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00356367 predicted 422
2 SASI_Hs01_00058260 predicted 722
3 SASI_Hs01_00058261 predicted 331
4 SASI_Hs01_00058262 predicted 251
5 SASI_Hs01_00058264 predicted 610
6 SASI_Hs01_00058266 predicted 538
7 SASI_Hs01_00058267 predicted 302
8 SASI_Hs01_00058268 predicted 788
9 SASI_Hs02_00356368 predicted 226
10 SASI_Hs02_00356369 predicted 592
11 SASI_Hs01_00058259 predicted 860
12 SASI_Hs01_00058263 predicted 212
13 SASI_Hs01_00058265 predicted 593
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023917
TAS2R9 MISSION shRNA Bacterial Glycerol Stock
taste receptor, type 2, member 9
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000014163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023917.1-207s1c1
Sequence:CCGGGCTGCTCTTTCCAGGTACATACTCGAGTATGTACCTGGAAAGAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023917.1-787s1c1
Sequence:CCGGGTGTTGATGATTGGTGACATACTCGAGTATGTCACCAATCATCAACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023917.1-369s1c1
Sequence:CCGGGCTAAAGATCAACAAGGTCATCTCGAGATGACCTTGTTGATCTTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023917.1-237s1c1
Sequence:CCGGCGTGCTAGTAAGCATTGTGAACTCGAGTTCACAATGCTTACTAGCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023917.1-523s1c1
Sequence:CCGGCCAGGTACTTTCAAACAGTTACTCGAGTAACTGTTTGAAAGTACCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023917.2-416s21c1
Sequence:CCGGTACTCAAGATAGCCAATATATCTCGAGATATATTGGCTATCTTGAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023917.2-301s21c1
Sequence:CCGGCTGCTCTTTCCAGGTACATATCTCGAGATATGTACCTGGAAAGAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023917.2-137s21c1
Sequence:CCGGGTGAATTGACCATAGGGATTTCTCGAGAAATCCCTATGGTCAATTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023917.2-885s21c1
Sequence:CCGGGATGATTGGTGACATAGTAACCTCGAGGTTACTATGTCACCAATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023917
TAS2R9 MISSION shRNA shRNA Plasmid DNA
taste receptor, type 2, member 9
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000014163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023917.1-207s1c1
Sequence:CCGGGCTGCTCTTTCCAGGTACATACTCGAGTATGTACCTGGAAAGAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023917.1-787s1c1
Sequence:CCGGGTGTTGATGATTGGTGACATACTCGAGTATGTCACCAATCATCAACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023917.1-369s1c1
Sequence:CCGGGCTAAAGATCAACAAGGTCATCTCGAGATGACCTTGTTGATCTTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023917.1-237s1c1
Sequence:CCGGCGTGCTAGTAAGCATTGTGAACTCGAGTTCACAATGCTTACTAGCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023917.1-523s1c1
Sequence:CCGGCCAGGTACTTTCAAACAGTTACTCGAGTAACTGTTTGAAAGTACCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023917.2-416s21c1
Sequence:CCGGTACTCAAGATAGCCAATATATCTCGAGATATATTGGCTATCTTGAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023917.2-301s21c1
Sequence:CCGGCTGCTCTTTCCAGGTACATATCTCGAGATATGTACCTGGAAAGAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023917.2-137s21c1
Sequence:CCGGGTGAATTGACCATAGGGATTTCTCGAGAAATCCCTATGGTCAATTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023917.2-885s21c1
Sequence:CCGGGATGATTGGTGACATAGTAACCTCGAGGTTACTATGTCACCAATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023917
TAS2R9 MISSION shRNA Lentiviral Transduction Particles
taste receptor, type 2, member 9
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000014163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023917.1-207s1c1
Sequence:CCGGGCTGCTCTTTCCAGGTACATACTCGAGTATGTACCTGGAAAGAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023917.1-787s1c1
Sequence:CCGGGTGTTGATGATTGGTGACATACTCGAGTATGTCACCAATCATCAACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023917.1-369s1c1
Sequence:CCGGGCTAAAGATCAACAAGGTCATCTCGAGATGACCTTGTTGATCTTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023917.1-237s1c1
Sequence:CCGGCGTGCTAGTAAGCATTGTGAACTCGAGTTCACAATGCTTACTAGCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023917.1-523s1c1
Sequence:CCGGCCAGGTACTTTCAAACAGTTACTCGAGTAACTGTTTGAAAGTACCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023917.2-416s21c1
Sequence:CCGGTACTCAAGATAGCCAATATATCTCGAGATATATTGGCTATCTTGAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023917.2-301s21c1
Sequence:CCGGCTGCTCTTTCCAGGTACATATCTCGAGATATGTACCTGGAAAGAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023917.2-137s21c1
Sequence:CCGGGTGAATTGACCATAGGGATTTCTCGAGAAATCCCTATGGTCAATTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023917.2-885s21c1
Sequence:CCGGGATGATTGGTGACATAGTAACCTCGAGGTTACTATGTCACCAATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks