EMAIL THIS PAGE TO A FRIEND

TASP1

taspase, threonine aspartase, 1

Synonyms: C20orf13 dJ585I14.2
UniProtKB ID: Q9H6P5, Q5TDU9, Q9BQN0, Q9NQ08, Q9NTS6, Q9NXJ2
Gene ID:
Human(55617) Summary: This gene encodes an endopeptidase that cleaves specific substrates following aspartate residues. The encoded protein undergoes posttranslational autoproteolytic processing to generate alpha and beta subunits, which reassemble into the active alpha2-beta2 heterotetramer. It is required to cleave MLL, a protein required for the maintenance of HOX gene expression, and TFIIA, a basal transcription factor. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
Mouse(75812) taspase, threonine aspartase 1
Rat(311468) taspase, threonine aspartase 1
Zebrafish(566980) taspase, threonine aspartase, 1
chicken(416741) taspase, threonine aspartase, 1
dog(477152) taspase, threonine aspartase, 1
Horse(100051126) taspase, threonine aspartase, 1
domestic cat(101094499) taspase, threonine aspartase, 1
cow(532606) taspase, threonine aspartase, 1
sheep(101110528) taspase, threonine aspartase, 1
domestic guinea pig(100716290) taspase, threonine aspartase, 1
naked mole-rat(101703788) taspase, threonine aspartase, 1
110 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017714 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017714 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017714 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175225 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175225 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175225 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017714 Rosetta Predictions human pricing
NM_001044243 Rosetta Predictions rat pricing
NM_175225 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017714 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00187376 predicted 999
2 SASI_Hs01_00187378 predicted 683
3 SASI_Hs01_00187379 predicted 316
4 SASI_Hs01_00187381 predicted 419
5 SASI_Hs02_00350477 predicted 385
6 SASI_Hs01_00187383 predicted 199
7 SASI_Hs01_00187384 predicted 1004
8 SASI_Hs01_00187385 predicted 430
9 SASI_Hs02_00350478 predicted 712
10 SASI_Hs02_00350479 predicted 548
11 SASI_Hs01_00187377 predicted 1210
12 SASI_Hs01_00187380 predicted 1202
13 SASI_Hs01_00187382 predicted 302
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001044243 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00205157 predicted 396
2 SASI_Rn02_00205158 predicted 374
3 SASI_Rn02_00205159 predicted 695
4 SASI_Rn02_00205160 predicted 957
5 SASI_Rn02_00205161 predicted 824
6 SASI_Rn02_00205162 predicted 1013
7 SASI_Rn02_00205163 predicted 210
8 SASI_Rn02_00205164 predicted 647
9 SASI_Rn02_00205165 predicted 245
10 SASI_Rn02_00205166 predicted 1110
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175225 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00099435 predicted 966
2 SASI_Mm01_00099436 predicted 1236
3 SASI_Mm01_00099437 predicted 493
4 SASI_Mm01_00099438 predicted 1646
5 SASI_Mm01_00099439 predicted 1105
6 SASI_Mm01_00099440 predicted 1590
7 SASI_Mm01_00099441 predicted 398
8 SASI_Mm01_00099442 predicted 643
9 SASI_Mm01_00099443 predicted 639
10 SASI_Mm01_00099444 predicted 384
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017714
VALIDATED
TASP1 MISSION shRNA Bacterial Glycerol Stock
taspase, threonine aspartase, 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432143    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017714.2-1398s21c1
Sequence:CCGGGAAGCGTCTCAGAGGCATTTCCTCGAGGAAATGCCTCTGAGACGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420877    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017714.2-1770s21c1
Sequence:CCGGCAACTGTCGCTGATGTGATATCTCGAGATATCACATCAGCGACAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017714.2-169s21c1
Sequence:CCGGTCTCAGGTTTCGGCTGGTAAACTCGAGTTTACCAGCCGAAACCTGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017714.2-420s21c1
Sequence:CCGGAGGAATGGGATCTAATCTAAACTCGAGTTTAGATTAGATCCCATTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017714.2-208s21c1
Sequence:CCGGGAAACAAAGCAGTCCTATAAACTCGAGTTTATAGGACTGCTTTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017714.2-254s21c1
Sequence:CCGGTGCATGCAGGTGCAGGTTATCCTCGAGGATAACCTGCACCTGCATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_017714.1-1059s1c1
Sequence:CCGGCAAGTTTATCAGTTCACCTTTCTCGAGAAAGGTGAACTGATAAACTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017714.1-980s1c1
Sequence:CCGGGCACCATACTGGCTAGAGAATCTCGAGATTCTCTAGCCAGTATGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_017714.1-506s1c1
Sequence:CCGGCGGTTGCCAACAGACTCTTATCTCGAGATAAGAGTCTGTTGGCAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_017714.1-283s1c1
Sequence:CCGGCGAGCTTGTCAGAAGGCAATTCTCGAGAATTGCCTTCTGACAAGCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005963    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_017714.1-1625s1c1
Sequence:CCGGCCTCATTGTGTGACCAGGAATCTCGAGATTCCTGGTCACACAATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017714
VALIDATED
TASP1 MISSION shRNA shRNA Plasmid DNA
taspase, threonine aspartase, 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432143    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017714.2-1398s21c1
Sequence:CCGGGAAGCGTCTCAGAGGCATTTCCTCGAGGAAATGCCTCTGAGACGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420877    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017714.2-1770s21c1
Sequence:CCGGCAACTGTCGCTGATGTGATATCTCGAGATATCACATCAGCGACAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017714.2-169s21c1
Sequence:CCGGTCTCAGGTTTCGGCTGGTAAACTCGAGTTTACCAGCCGAAACCTGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017714.2-420s21c1
Sequence:CCGGAGGAATGGGATCTAATCTAAACTCGAGTTTAGATTAGATCCCATTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017714.2-208s21c1
Sequence:CCGGGAAACAAAGCAGTCCTATAAACTCGAGTTTATAGGACTGCTTTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017714.2-254s21c1
Sequence:CCGGTGCATGCAGGTGCAGGTTATCCTCGAGGATAACCTGCACCTGCATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_017714.1-1059s1c1
Sequence:CCGGCAAGTTTATCAGTTCACCTTTCTCGAGAAAGGTGAACTGATAAACTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017714.1-980s1c1
Sequence:CCGGGCACCATACTGGCTAGAGAATCTCGAGATTCTCTAGCCAGTATGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_017714.1-506s1c1
Sequence:CCGGCGGTTGCCAACAGACTCTTATCTCGAGATAAGAGTCTGTTGGCAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_017714.1-283s1c1
Sequence:CCGGCGAGCTTGTCAGAAGGCAATTCTCGAGAATTGCCTTCTGACAAGCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005963    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_017714.1-1625s1c1
Sequence:CCGGCCTCATTGTGTGACCAGGAATCTCGAGATTCCTGGTCACACAATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017714
VALIDATED
TASP1 MISSION shRNA Lentiviral Transduction Particles
taspase, threonine aspartase, 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432143    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017714.2-1398s21c1
Sequence:CCGGGAAGCGTCTCAGAGGCATTTCCTCGAGGAAATGCCTCTGAGACGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420877    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017714.2-1770s21c1
Sequence:CCGGCAACTGTCGCTGATGTGATATCTCGAGATATCACATCAGCGACAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017714.2-169s21c1
Sequence:CCGGTCTCAGGTTTCGGCTGGTAAACTCGAGTTTACCAGCCGAAACCTGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017714.2-420s21c1
Sequence:CCGGAGGAATGGGATCTAATCTAAACTCGAGTTTAGATTAGATCCCATTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017714.2-208s21c1
Sequence:CCGGGAAACAAAGCAGTCCTATAAACTCGAGTTTATAGGACTGCTTTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017714.2-254s21c1
Sequence:CCGGTGCATGCAGGTGCAGGTTATCCTCGAGGATAACCTGCACCTGCATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_017714.1-1059s1c1
Sequence:CCGGCAAGTTTATCAGTTCACCTTTCTCGAGAAAGGTGAACTGATAAACTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017714.1-980s1c1
Sequence:CCGGGCACCATACTGGCTAGAGAATCTCGAGATTCTCTAGCCAGTATGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_017714.1-506s1c1
Sequence:CCGGCGGTTGCCAACAGACTCTTATCTCGAGATAAGAGTCTGTTGGCAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_017714.1-283s1c1
Sequence:CCGGCGAGCTTGTCAGAAGGCAATTCTCGAGAATTGCCTTCTGACAAGCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005963    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_017714.1-1625s1c1
Sequence:CCGGCCTCATTGTGTGACCAGGAATCTCGAGATTCCTGGTCACACAATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175225
TASP1 MISSION shRNA Bacterial Glycerol Stock
taspase, threonine aspartase, 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175225.2-416s1c1
Sequence:CCGGGTAACAGTCAAGGAGTTAGAACTCGAGTTCTAACTCCTTGACTGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175225.2-1418s1c1
Sequence:CCGGCAAGATAAACAGACACTGCTTCTCGAGAAGCAGTGTCTGTTTATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175225.2-1238s1c1
Sequence:CCGGCGCACCATACTGGCTAGAGAACTCGAGTTCTCTAGCCAGTATGGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175225.2-662s1c1
Sequence:CCGGCTAAATCTCTTAGGAGAGATTCTCGAGAATCTCTCCTAAGAGATTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175225.2-1001s1c1
Sequence:CCGGCGACAATCAAGCGCAAAGGAACTCGAGTTCCTTTGCGCTTGATTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175225
TASP1 MISSION shRNA shRNA Plasmid DNA
taspase, threonine aspartase, 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175225.2-416s1c1
Sequence:CCGGGTAACAGTCAAGGAGTTAGAACTCGAGTTCTAACTCCTTGACTGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175225.2-1418s1c1
Sequence:CCGGCAAGATAAACAGACACTGCTTCTCGAGAAGCAGTGTCTGTTTATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175225.2-1238s1c1
Sequence:CCGGCGCACCATACTGGCTAGAGAACTCGAGTTCTCTAGCCAGTATGGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175225.2-662s1c1
Sequence:CCGGCTAAATCTCTTAGGAGAGATTCTCGAGAATCTCTCCTAAGAGATTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175225.2-1001s1c1
Sequence:CCGGCGACAATCAAGCGCAAAGGAACTCGAGTTCCTTTGCGCTTGATTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175225
TASP1 MISSION shRNA Lentiviral Transduction Particles
taspase, threonine aspartase, 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175225.2-416s1c1
Sequence:CCGGGTAACAGTCAAGGAGTTAGAACTCGAGTTCTAACTCCTTGACTGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175225.2-1418s1c1
Sequence:CCGGCAAGATAAACAGACACTGCTTCTCGAGAAGCAGTGTCTGTTTATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175225.2-1238s1c1
Sequence:CCGGCGCACCATACTGGCTAGAGAACTCGAGTTCTCTAGCCAGTATGGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175225.2-662s1c1
Sequence:CCGGCTAAATCTCTTAGGAGAGATTCTCGAGAATCTCTCCTAAGAGATTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175225.2-1001s1c1
Sequence:CCGGCGACAATCAAGCGCAAAGGAACTCGAGTTCCTTTGCGCTTGATTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks