EMAIL THIS PAGE TO A FRIEND

TAT

tyrosine aminotransferase

UniProtKB ID: P17735, B2R8I1, D3DWS2
Gene ID:
Human(6898) Summary: This nuclear gene encodes a mitochondrial protein tyrosine aminotransferase which is present in the liver and catalyzes the conversion of L-tyrosine into p-hydroxyphenylpyruvate. Mutations in this gene cause tyrosinemia (type II, Richner-Hanhart syndrome), a disorder accompanied by major skin and corneal lesions, with possible mental retardation. A regulator gene for tyrosine aminotransferase is X-linked. [provided by RefSeq, Jul 2008]
Mouse(234724) tyrosine aminotransferase
Rat(24813) tyrosine aminotransferase
cow(533481) tyrosine aminotransferase
sheep(101104679) tyrosine aminotransferase
naked mole-rat(101698939) tyrosine aminotransferase
domestic guinea pig(100727961) tyrosine aminotransferase
Zebrafish(561410) tyrosine aminotransferase
chicken(415884) tyrosine aminotransferase
dog(479665) tyrosine aminotransferase
Horse(100068116) tyrosine aminotransferase
domestic cat(101080599) tyrosine aminotransferase
116 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1303103 ANTI-TAT (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, immunohistochemistry, western blot pricing
SAB2106810 Anti-TAT antibody produced in rabbit affinity isolated antibody rat, horse, human, guinea pig
ELISA, western blot pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
M8046 Mifepristone ≥98% human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000353 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000353 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000353 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_146214 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146214 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146214 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU031861 MISSION® esiRNA esiRNA human TAT (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000353 Rosetta Predictions human pricing
NM_012668 Rosetta Predictions rat pricing
NM_146214 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000353 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00199330 predicted 310
2 SASI_Hs02_00302394 predicted 596
3 SASI_Hs01_00199332 predicted 1133
4 SASI_Hs01_00199333 predicted 634
5 SASI_Hs01_00199334 predicted 1315
6 SASI_Hs01_00199335 predicted 1328
7 SASI_Hs02_00302395 predicted 701
8 SASI_Hs01_00199336 predicted 1237
9 SASI_Hs02_00302396 predicted 366
10 SASI_Hs01_00199337 predicted 1465
11 SASI_Hs01_00199331 predicted 1286
12 SASI_Hs01_00199338 predicted 577
13 SASI_Hs01_00199339 predicted 1245
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012668 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00103096 predicted 576
2 SASI_Rn02_00259938 predicted 577
3 SASI_Rn01_00103097 predicted 644
4 SASI_Rn01_00103098 predicted 1278
5 SASI_Rn01_00103099 predicted 1159
6 SASI_Rn02_00259939 predicted 405
7 SASI_Rn01_00103100 predicted 311
8 SASI_Rn01_00103102 predicted 1208
9 SASI_Rn01_00103103 predicted 1173
10 SASI_Rn01_00103104 predicted 1045
11 SASI_Rn01_00103101 predicted 1238
12 SASI_Rn01_00103105 predicted 505
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146214 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00341912 predicted 1251
2 SASI_Mm02_00341913 predicted 1344
3 SASI_Mm01_00201829 predicted 1076
4 SASI_Mm01_00201830 predicted 1306
5 SASI_Mm01_00201831 predicted 1242
6 SASI_Mm01_00201832 predicted 1090
7 SASI_Mm01_00201833 predicted 1195
8 SASI_Mm01_00201834 predicted 953
9 SASI_Mm01_00201835 predicted 247
10 SASI_Mm02_00341914 predicted 672
11 SASI_Mm01_00201828 predicted 675
12 SASI_Mm01_00201836 predicted 953
13 SASI_Mm01_00201837 predicted 1186
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000353
TAT MISSION shRNA Bacterial Glycerol Stock
tyrosine aminotransferase
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000035219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000353.1-451s1c1
Sequence:CCGGCGGGAGGAGATTGCTTCTTATCTCGAGATAAGAAGCAATCTCCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000353.1-724s1c1
Sequence:CCGGGCTTGTCTCATTGTCAATAATCTCGAGATTATTGACAATGAGACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000353.1-530s1c1
Sequence:CCGGGCCAAGCTATTGACCTTTGTTCTCGAGAACAAAGGTCAATAGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000353.1-274s1c1
Sequence:CCGGGTGGACAACATGAAGGTGAAACTCGAGTTTCACCTTCATGTTGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000353.1-1319s1c1
Sequence:CCGGCGTGCTTTGAGTACCCGAATTCTCGAGAATTCGGGTACTCAAAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000353.2-1028s21c1
Sequence:CCGGTGAAGCTGAGTCAGCGCATTTCTCGAGAAATGCGCTGACTCAGCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000353.2-1227s21c1
Sequence:CCGGTGGAATTGAGATGGAACATTTCTCGAGAAATGTTCCATCTCAATTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000353.2-667s21c1
Sequence:CCGGCCAGAGAAATCTTGGGAAATTCTCGAGAATTTCCCAAGATTTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000353.2-693s21c1
Sequence:CCGGGAAACAACTGGAATATCTAATCTCGAGATTAGATATTCCAGTTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000353.2-770s21c1
Sequence:CCGGTGTTCAGCAAACGTCATCTTCCTCGAGGAAGATGACGTTTGCTGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000353.2-830s21c1
Sequence:CCGGTCTTAGCTGATGAGATCTATGCTCGAGCATAGATCTCATCAGCTAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000353.2-152s21c1
Sequence:CCGGTGGACGTGCATGTCAACGTTGCTCGAGCAACGTTGACATGCACGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000353.2-497s21c1
Sequence:CCGGTAGAAGCTAAGGACGTCATTCCTCGAGGAATGACGTCCTTAGCTTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000353
TAT MISSION shRNA shRNA Plasmid DNA
tyrosine aminotransferase
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000035219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000353.1-451s1c1
Sequence:CCGGCGGGAGGAGATTGCTTCTTATCTCGAGATAAGAAGCAATCTCCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000353.1-724s1c1
Sequence:CCGGGCTTGTCTCATTGTCAATAATCTCGAGATTATTGACAATGAGACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000353.1-530s1c1
Sequence:CCGGGCCAAGCTATTGACCTTTGTTCTCGAGAACAAAGGTCAATAGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000353.1-274s1c1
Sequence:CCGGGTGGACAACATGAAGGTGAAACTCGAGTTTCACCTTCATGTTGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000353.1-1319s1c1
Sequence:CCGGCGTGCTTTGAGTACCCGAATTCTCGAGAATTCGGGTACTCAAAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000353.2-1028s21c1
Sequence:CCGGTGAAGCTGAGTCAGCGCATTTCTCGAGAAATGCGCTGACTCAGCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000353.2-1227s21c1
Sequence:CCGGTGGAATTGAGATGGAACATTTCTCGAGAAATGTTCCATCTCAATTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000353.2-667s21c1
Sequence:CCGGCCAGAGAAATCTTGGGAAATTCTCGAGAATTTCCCAAGATTTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000353.2-693s21c1
Sequence:CCGGGAAACAACTGGAATATCTAATCTCGAGATTAGATATTCCAGTTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000353.2-770s21c1
Sequence:CCGGTGTTCAGCAAACGTCATCTTCCTCGAGGAAGATGACGTTTGCTGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000353.2-830s21c1
Sequence:CCGGTCTTAGCTGATGAGATCTATGCTCGAGCATAGATCTCATCAGCTAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000353.2-152s21c1
Sequence:CCGGTGGACGTGCATGTCAACGTTGCTCGAGCAACGTTGACATGCACGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000353.2-497s21c1
Sequence:CCGGTAGAAGCTAAGGACGTCATTCCTCGAGGAATGACGTCCTTAGCTTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000353
TAT MISSION shRNA Lentiviral Transduction Particles
tyrosine aminotransferase
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000035219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000353.1-451s1c1
Sequence:CCGGCGGGAGGAGATTGCTTCTTATCTCGAGATAAGAAGCAATCTCCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000353.1-724s1c1
Sequence:CCGGGCTTGTCTCATTGTCAATAATCTCGAGATTATTGACAATGAGACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000353.1-530s1c1
Sequence:CCGGGCCAAGCTATTGACCTTTGTTCTCGAGAACAAAGGTCAATAGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000353.1-274s1c1
Sequence:CCGGGTGGACAACATGAAGGTGAAACTCGAGTTTCACCTTCATGTTGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000353.1-1319s1c1
Sequence:CCGGCGTGCTTTGAGTACCCGAATTCTCGAGAATTCGGGTACTCAAAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000353.2-1028s21c1
Sequence:CCGGTGAAGCTGAGTCAGCGCATTTCTCGAGAAATGCGCTGACTCAGCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000353.2-1227s21c1
Sequence:CCGGTGGAATTGAGATGGAACATTTCTCGAGAAATGTTCCATCTCAATTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000353.2-667s21c1
Sequence:CCGGCCAGAGAAATCTTGGGAAATTCTCGAGAATTTCCCAAGATTTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000353.2-693s21c1
Sequence:CCGGGAAACAACTGGAATATCTAATCTCGAGATTAGATATTCCAGTTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000353.2-770s21c1
Sequence:CCGGTGTTCAGCAAACGTCATCTTCCTCGAGGAAGATGACGTTTGCTGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000353.2-830s21c1
Sequence:CCGGTCTTAGCTGATGAGATCTATGCTCGAGCATAGATCTCATCAGCTAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000353.2-152s21c1
Sequence:CCGGTGGACGTGCATGTCAACGTTGCTCGAGCAACGTTGACATGCACGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000353.2-497s21c1
Sequence:CCGGTAGAAGCTAAGGACGTCATTCCTCGAGGAATGACGTCCTTAGCTTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146214
TAT MISSION shRNA Bacterial Glycerol Stock
tyrosine aminotransferase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119787    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146214.1-1545s1c1
Sequence:CCGGCGCATCAAGATTTGAAGATTACTCGAGTAATCTTCAAATCTTGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146214.1-209s1c1
Sequence:CCGGCCCTCTGACATGTCCAATAAACTCGAGTTTATTGGACATGTCAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146214.1-631s1c1
Sequence:CCGGCTACAATCTATTGCCTGAGAACTCGAGTTCTCAGGCAATAGATTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146214.1-126s1c1
Sequence:CCGGTGCTGGATGTTCGCGTCAATACTCGAGTATTGACGCGAACATCCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146214.1-1188s1c1
Sequence:CCGGCCATGTACCTTATGGTGGGAACTCGAGTTCCCACCATAAGGTACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146214
TAT MISSION shRNA shRNA Plasmid DNA
tyrosine aminotransferase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119787    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146214.1-1545s1c1
Sequence:CCGGCGCATCAAGATTTGAAGATTACTCGAGTAATCTTCAAATCTTGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146214.1-209s1c1
Sequence:CCGGCCCTCTGACATGTCCAATAAACTCGAGTTTATTGGACATGTCAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146214.1-631s1c1
Sequence:CCGGCTACAATCTATTGCCTGAGAACTCGAGTTCTCAGGCAATAGATTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146214.1-126s1c1
Sequence:CCGGTGCTGGATGTTCGCGTCAATACTCGAGTATTGACGCGAACATCCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146214.1-1188s1c1
Sequence:CCGGCCATGTACCTTATGGTGGGAACTCGAGTTCCCACCATAAGGTACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146214
TAT MISSION shRNA Lentiviral Transduction Particles
tyrosine aminotransferase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119787    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146214.1-1545s1c1
Sequence:CCGGCGCATCAAGATTTGAAGATTACTCGAGTAATCTTCAAATCTTGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146214.1-209s1c1
Sequence:CCGGCCCTCTGACATGTCCAATAAACTCGAGTTTATTGGACATGTCAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146214.1-631s1c1
Sequence:CCGGCTACAATCTATTGCCTGAGAACTCGAGTTCTCAGGCAATAGATTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146214.1-126s1c1
Sequence:CCGGTGCTGGATGTTCGCGTCAATACTCGAGTATTGACGCGAACATCCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146214.1-1188s1c1
Sequence:CCGGCCATGTACCTTATGGTGGGAACTCGAGTTCCCACCATAAGGTACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks