EMAIL THIS PAGE TO A FRIEND

TATDN1

TatD DNase domain containing 1

UniProtKB ID: Q6P1N9, B2R5J0, Q8TD02, Q9BY40
Gene ID:
Mouse(69694) TatD DNase domain containing 1
Rat(362917) TatD DNase domain containing 1
Zebrafish(100151626) TatD DNase domain containing 1
dog(475093) TatD DNase domain containing 1
domestic cat(101085437) TatD DNase domain containing 1
chicken(770677) TatD DNase domain containing 1
domestic guinea pig(100733776) TatD DNase domain containing 1
naked mole-rat(101713636) TatD DNase domain containing 1
cow(509365) TatD DNase domain containing 1
sheep(101106439) TatD DNase domain containing 1
49 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175151 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175151 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175151 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032026 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032026 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032026 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032026 Rosetta Predictions human pricing
XM_343247 Rosetta Predictions rat pricing
NM_175151 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032026 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00053379 predicted 285
2 SASI_Hs01_00053380 predicted 250
3 SASI_Hs01_00053381 predicted 334
4 SASI_Hs01_00053382 predicted 339
5 SASI_Hs01_00053383 predicted 568
6 SASI_Hs01_00053386 predicted 576
7 SASI_Hs01_00053387 predicted 629
8 SASI_Hs02_00359214 predicted 258
9 SASI_Hs02_00359215 predicted 205
10 SASI_Hs02_00359216 predicted 683
11 SASI_Hs01_00053378 predicted 398
12 SASI_Hs01_00053384 predicted 401
13 SASI_Hs01_00053385 predicted 394
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343247 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00152569 predicted 597
2 SASI_Rn01_00152570 predicted 595
3 SASI_Rn01_00152571 predicted 694
4 SASI_Rn01_00152572 predicted 663
5 SASI_Rn01_00152573 predicted 598
6 SASI_Rn01_00152574 predicted 230
7 SASI_Rn01_00152575 predicted 714
8 SASI_Rn01_00152576 predicted 681
9 SASI_Rn01_00152577 predicted 832
10 SASI_Rn01_00152578 predicted 553
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175151 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00058821 predicted 892
2 SASI_Mm01_00058822 predicted 401
3 SASI_Mm01_00058823 predicted 653
4 SASI_Mm01_00058824 predicted 482
5 SASI_Mm01_00058825 predicted 360
6 SASI_Mm02_00345790 predicted 901
7 SASI_Mm01_00058826 predicted 454
8 SASI_Mm01_00058827 predicted 477
9 SASI_Mm01_00058828 predicted 596
10 SASI_Mm02_00345791 predicted 796
11 SASI_Mm01_00058820 predicted 404
12 SASI_Mm01_00058829 predicted 583
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175151
TATDN1 MISSION shRNA Bacterial Glycerol Stock
TatD DNase domain containing 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000445839    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175151.4-1020s21c1
Sequence:CCGGGTGACCGACGGATTAGGTAAACTCGAGTTTACCTAATCCGTCGGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175151.4-144s21c1
Sequence:CCGGAGCTATCCAGATTGGTGTTAACTCGAGTTAACACCAATCTGGATAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175151.4-467s21c1
Sequence:CCGGTGTTTCTTCATTGTCGCAATTCTCGAGAATTGCGACAATGAAGAAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175151.2-61s1c1
Sequence:CCGGCATCAACCTGACAGATCCTATCTCGAGATAGGATCTGTCAGGTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176674    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175151.2-979s1c1
Sequence:CCGGCCTCACCTGTAAAGTCTAAATCTCGAGATTTAGACTTTACAGGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177684    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175151.2-64s1c1
Sequence:CCGGCAACCTGACAGATCCTATGTTCTCGAGAACATAGGATCTGTCAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175151.2-113s1c1
Sequence:CCGGCATCAAGATGACTTACAAGATCTCGAGATCTTGTAAGTCATCTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175151.2-443s1c1
Sequence:CCGGCTGTCAGAACAAACACAATTACTCGAGTAATTGTGTTTGTTCTGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177546    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175151.2-1201s1c1
Sequence:CCGGCCAACCTTTCAATAGCAAGAACTCGAGTTCTTGCTATTGAAAGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175151
TATDN1 MISSION shRNA shRNA Plasmid DNA
TatD DNase domain containing 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000445839    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175151.4-1020s21c1
Sequence:CCGGGTGACCGACGGATTAGGTAAACTCGAGTTTACCTAATCCGTCGGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175151.4-144s21c1
Sequence:CCGGAGCTATCCAGATTGGTGTTAACTCGAGTTAACACCAATCTGGATAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175151.4-467s21c1
Sequence:CCGGTGTTTCTTCATTGTCGCAATTCTCGAGAATTGCGACAATGAAGAAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175151.2-61s1c1
Sequence:CCGGCATCAACCTGACAGATCCTATCTCGAGATAGGATCTGTCAGGTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176674    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175151.2-979s1c1
Sequence:CCGGCCTCACCTGTAAAGTCTAAATCTCGAGATTTAGACTTTACAGGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177684    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175151.2-64s1c1
Sequence:CCGGCAACCTGACAGATCCTATGTTCTCGAGAACATAGGATCTGTCAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175151.2-113s1c1
Sequence:CCGGCATCAAGATGACTTACAAGATCTCGAGATCTTGTAAGTCATCTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175151.2-443s1c1
Sequence:CCGGCTGTCAGAACAAACACAATTACTCGAGTAATTGTGTTTGTTCTGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177546    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175151.2-1201s1c1
Sequence:CCGGCCAACCTTTCAATAGCAAGAACTCGAGTTCTTGCTATTGAAAGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175151
TATDN1 MISSION shRNA Lentiviral Transduction Particles
TatD DNase domain containing 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000445839    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175151.4-1020s21c1
Sequence:CCGGGTGACCGACGGATTAGGTAAACTCGAGTTTACCTAATCCGTCGGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175151.4-144s21c1
Sequence:CCGGAGCTATCCAGATTGGTGTTAACTCGAGTTAACACCAATCTGGATAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175151.4-467s21c1
Sequence:CCGGTGTTTCTTCATTGTCGCAATTCTCGAGAATTGCGACAATGAAGAAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175151.2-61s1c1
Sequence:CCGGCATCAACCTGACAGATCCTATCTCGAGATAGGATCTGTCAGGTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176674    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175151.2-979s1c1
Sequence:CCGGCCTCACCTGTAAAGTCTAAATCTCGAGATTTAGACTTTACAGGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177684    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175151.2-64s1c1
Sequence:CCGGCAACCTGACAGATCCTATGTTCTCGAGAACATAGGATCTGTCAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175151.2-113s1c1
Sequence:CCGGCATCAAGATGACTTACAAGATCTCGAGATCTTGTAAGTCATCTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175151.2-443s1c1
Sequence:CCGGCTGTCAGAACAAACACAATTACTCGAGTAATTGTGTTTGTTCTGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177546    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175151.2-1201s1c1
Sequence:CCGGCCAACCTTTCAATAGCAAGAACTCGAGTTCTTGCTATTGAAAGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032026
VALIDATED
TATDN1 MISSION shRNA Bacterial Glycerol Stock
TatD DNase domain containing 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000424867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032026.3-493s21c1
Sequence:CCGGCGAAACTCACATGCTGAATTTCTCGAGAAATTCAGCATGTGAGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032026.3-597s21c1
Sequence:CCGCTTTGATTGACTTGGATCTTTACTCGAGTAAAGATCCAAGTCAATCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032026.3-197s21c1
Sequence:CCGGGAAATCTACAAGACAGTAAAGCTCGAGCTTTACTGTCTTGTAGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032026.1-857s1c1
Sequence:CCGGCCACTGGAATTAGCCAATACACTCGAGTGTATTGGCTAATTCCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_032026.1-140s1c1
Sequence:CCGGGCTGTCGAGATTGGTGTTAAACTCGAGTTTAACACCAATCTCGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_032026.1-243s1c1
Sequence:CCGGCAGTTGGATGTCATCCTACAACTCGAGTTGTAGGATGACATCCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_032026.1-350s1c1
Sequence:CCGGGCAATAGGAGAATGCGGACTTCTCGAGAAGTCCGCATTCTCCTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_032026.1-791s1c1
Sequence:CCGGGACAGAAATGAACCCTGCCATCTCGAGATGGCAGGGTTCATTTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032026
VALIDATED
TATDN1 MISSION shRNA shRNA Plasmid DNA
TatD DNase domain containing 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000424867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032026.3-493s21c1
Sequence:CCGGCGAAACTCACATGCTGAATTTCTCGAGAAATTCAGCATGTGAGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032026.3-597s21c1
Sequence:CCGCTTTGATTGACTTGGATCTTTACTCGAGTAAAGATCCAAGTCAATCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032026.3-197s21c1
Sequence:CCGGGAAATCTACAAGACAGTAAAGCTCGAGCTTTACTGTCTTGTAGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032026.1-857s1c1
Sequence:CCGGCCACTGGAATTAGCCAATACACTCGAGTGTATTGGCTAATTCCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_032026.1-140s1c1
Sequence:CCGGGCTGTCGAGATTGGTGTTAAACTCGAGTTTAACACCAATCTCGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_032026.1-243s1c1
Sequence:CCGGCAGTTGGATGTCATCCTACAACTCGAGTTGTAGGATGACATCCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_032026.1-350s1c1
Sequence:CCGGGCAATAGGAGAATGCGGACTTCTCGAGAAGTCCGCATTCTCCTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_032026.1-791s1c1
Sequence:CCGGGACAGAAATGAACCCTGCCATCTCGAGATGGCAGGGTTCATTTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032026
VALIDATED
TATDN1 MISSION shRNA Lentiviral Transduction Particles
TatD DNase domain containing 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000424867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032026.3-493s21c1
Sequence:CCGGCGAAACTCACATGCTGAATTTCTCGAGAAATTCAGCATGTGAGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032026.3-597s21c1
Sequence:CCGCTTTGATTGACTTGGATCTTTACTCGAGTAAAGATCCAAGTCAATCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032026.3-197s21c1
Sequence:CCGGGAAATCTACAAGACAGTAAAGCTCGAGCTTTACTGTCTTGTAGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032026.1-857s1c1
Sequence:CCGGCCACTGGAATTAGCCAATACACTCGAGTGTATTGGCTAATTCCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_032026.1-140s1c1
Sequence:CCGGGCTGTCGAGATTGGTGTTAAACTCGAGTTTAACACCAATCTCGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_032026.1-243s1c1
Sequence:CCGGCAGTTGGATGTCATCCTACAACTCGAGTTGTAGGATGACATCCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_032026.1-350s1c1
Sequence:CCGGGCAATAGGAGAATGCGGACTTCTCGAGAAGTCCGCATTCTCCTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_032026.1-791s1c1
Sequence:CCGGGACAGAAATGAACCCTGCCATCTCGAGATGGCAGGGTTCATTTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks