EMAIL THIS PAGE TO A FRIEND

TATDN2

TatD DNase domain containing 2

UniProtKB ID: Q93075, Q3MIL9, Q5BKU0
Gene ID:
Mouse(381801) TatD DNase domain containing 2
Rat(500295) TatD DNase domain containing 2
Zebrafish(557931) TatD DNase domain containing 2
domestic cat(101087142) TatD DNase domain containing 2
Horse(100051750) TatD DNase domain containing 2
dog(484656) TatD DNase domain containing 2
cow(510836) TatD DNase domain containing 2
sheep(101121974) TatD DNase domain containing 2
naked mole-rat(101710843) TatD DNase domain containing 2
domestic guinea pig(100728671) TatD DNase domain containing 2
67 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001033463 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033463 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033463 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_376203 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_376203 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_376203 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_014760 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014760 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014760 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014760 Rosetta Predictions human pricing
NM_001109252 Rosetta Predictions rat pricing
NM_001033463 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014760 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00207874 predicted 2354
2 SASI_Hs01_00207875 predicted 2060
3 SASI_Hs02_00346237 predicted 1649
4 SASI_Hs01_00207877 predicted 1871
5 SASI_Hs01_00207878 predicted 2257
6 SASI_Hs01_00207879 predicted 584
7 SASI_Hs01_00207881 predicted 1737
8 SASI_Hs01_00207882 predicted 2065
9 SASI_Hs02_00346238 predicted 1681
10 SASI_Hs02_00346239 predicted 522
11 SASI_Hs01_00207873 predicted 571
12 SASI_Hs01_00207876 predicted 972
13 SASI_Hs01_00207880 predicted 967
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109252 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00246584 predicted 487
2 SASI_Rn02_00246585 predicted 1390
3 SASI_Rn02_00246586 predicted 810
4 SASI_Rn02_00246587 predicted 684
5 SASI_Rn02_00246588 predicted 714
6 SASI_Rn02_00246589 predicted 1640
7 SASI_Rn02_00246590 predicted 2335
8 SASI_Rn02_00246591 predicted 1378
9 SASI_Rn02_00246592 predicted 1800
10 SASI_Rn02_00246593 predicted 2495
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033463 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00288802 predicted 2242
2 SASI_Mm02_00288803 predicted 1397
3 SASI_Mm02_00288804 predicted 1167
4 SASI_Mm02_00288805 predicted 2117
5 SASI_Mm02_00288806 predicted 1886
6 SASI_Mm02_00288807 predicted 1570
7 SASI_Mm02_00288808 predicted 1484
8 SASI_Mm02_00288809 predicted 932
9 SASI_Mm02_00288810 predicted 1185
10 SASI_Mm02_00288811 predicted 611
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033463
TATDN2 MISSION shRNA Bacterial Glycerol Stock
TatD DNase domain containing 2
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033463.1-1505s1c1
Sequence:CCGGGCTCTACTCCAAGCTGTCTTTCTCGAGAAAGACAGCTTGGAGTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033463.1-1893s1c1
Sequence:CCGGGCTGATGAAGATTTGTTGGATCTCGAGATCCAACAAATCTTCATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033463.1-907s1c1
Sequence:CCGGCAAAGGTTACAGTTACTGTTTCTCGAGAAACAGTAACTGTAACCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182724    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001033463.1-2407s1c1
Sequence:CCGGGATGTTACCTTGGACCCTCATCTCGAGATGAGGGTCCAAGGTAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200217    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033463.1-1943s1c1
Sequence:CCGGCAAGATCCATAGGCACTGCTTCTCGAGAAGCAGTGCCTATGGATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200018    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001033463.1-2422s1c1
Sequence:CCGGCCTCATCACAAGGCTTCACTTCTCGAGAAGTGAAGCCTTGTGATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217321    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033463.3-493s1c1
Sequence:CCGGGAAGGAAGCTTGTAGCGTTAACTCGAGTTAACGCTACAAGCTTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033463
TATDN2 MISSION shRNA shRNA Plasmid DNA
TatD DNase domain containing 2
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033463.1-1505s1c1
Sequence:CCGGGCTCTACTCCAAGCTGTCTTTCTCGAGAAAGACAGCTTGGAGTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033463.1-1893s1c1
Sequence:CCGGGCTGATGAAGATTTGTTGGATCTCGAGATCCAACAAATCTTCATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033463.1-907s1c1
Sequence:CCGGCAAAGGTTACAGTTACTGTTTCTCGAGAAACAGTAACTGTAACCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182724    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001033463.1-2407s1c1
Sequence:CCGGGATGTTACCTTGGACCCTCATCTCGAGATGAGGGTCCAAGGTAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200217    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033463.1-1943s1c1
Sequence:CCGGCAAGATCCATAGGCACTGCTTCTCGAGAAGCAGTGCCTATGGATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200018    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001033463.1-2422s1c1
Sequence:CCGGCCTCATCACAAGGCTTCACTTCTCGAGAAGTGAAGCCTTGTGATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217321    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033463.3-493s1c1
Sequence:CCGGGAAGGAAGCTTGTAGCGTTAACTCGAGTTAACGCTACAAGCTTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033463
TATDN2 MISSION shRNA Lentiviral Transduction Particles
TatD DNase domain containing 2
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033463.1-1505s1c1
Sequence:CCGGGCTCTACTCCAAGCTGTCTTTCTCGAGAAAGACAGCTTGGAGTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033463.1-1893s1c1
Sequence:CCGGGCTGATGAAGATTTGTTGGATCTCGAGATCCAACAAATCTTCATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033463.1-907s1c1
Sequence:CCGGCAAAGGTTACAGTTACTGTTTCTCGAGAAACAGTAACTGTAACCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182724    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001033463.1-2407s1c1
Sequence:CCGGGATGTTACCTTGGACCCTCATCTCGAGATGAGGGTCCAAGGTAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200217    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033463.1-1943s1c1
Sequence:CCGGCAAGATCCATAGGCACTGCTTCTCGAGAAGCAGTGCCTATGGATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200018    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001033463.1-2422s1c1
Sequence:CCGGCCTCATCACAAGGCTTCACTTCTCGAGAAGTGAAGCCTTGTGATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217321    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033463.3-493s1c1
Sequence:CCGGGAAGGAAGCTTGTAGCGTTAACTCGAGTTAACGCTACAAGCTTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_376203
VALIDATED
TATDN2 MISSION shRNA Bacterial Glycerol Stock
TatD DNase domain containing 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000049828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376203.1-1909s1c1
Sequence:CCGGGCTCTATTCCAAGCTATCTTTCTCGAGAAAGATAGCTTGGAATAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376203.1-1268s1c1
Sequence:CCGGCGAAGGACTGTCATTGACAAACTCGAGTTTGTCAATGACAGTCCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376203.1-756s1c1
Sequence:CCGGCCAACGCCTCTTTGGAAGAAACTCGAGTTTCTTCCAAAGAGGCGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:XM_376203.1-2251s1c1
Sequence:CCGGGCTGGCTGTGTCTCTAAAGAACTCGAGTTCTTTAGAGACACAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:XM_376203.1-2597s1c1
Sequence:CCGGCGAGAGATTGCCAGAGTCAAACTCGAGTTTGACTCTGGCAATCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_376203
VALIDATED
TATDN2 MISSION shRNA shRNA Plasmid DNA
TatD DNase domain containing 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000049828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376203.1-1909s1c1
Sequence:CCGGGCTCTATTCCAAGCTATCTTTCTCGAGAAAGATAGCTTGGAATAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376203.1-1268s1c1
Sequence:CCGGCGAAGGACTGTCATTGACAAACTCGAGTTTGTCAATGACAGTCCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376203.1-756s1c1
Sequence:CCGGCCAACGCCTCTTTGGAAGAAACTCGAGTTTCTTCCAAAGAGGCGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:XM_376203.1-2251s1c1
Sequence:CCGGGCTGGCTGTGTCTCTAAAGAACTCGAGTTCTTTAGAGACACAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:XM_376203.1-2597s1c1
Sequence:CCGGCGAGAGATTGCCAGAGTCAAACTCGAGTTTGACTCTGGCAATCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_376203
VALIDATED
TATDN2 MISSION shRNA Lentiviral Transduction Particles
TatD DNase domain containing 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000049828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376203.1-1909s1c1
Sequence:CCGGGCTCTATTCCAAGCTATCTTTCTCGAGAAAGATAGCTTGGAATAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376203.1-1268s1c1
Sequence:CCGGCGAAGGACTGTCATTGACAAACTCGAGTTTGTCAATGACAGTCCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376203.1-756s1c1
Sequence:CCGGCCAACGCCTCTTTGGAAGAAACTCGAGTTTCTTCCAAAGAGGCGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:XM_376203.1-2251s1c1
Sequence:CCGGGCTGGCTGTGTCTCTAAAGAACTCGAGTTCTTTAGAGACACAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:XM_376203.1-2597s1c1
Sequence:CCGGCGAGAGATTGCCAGAGTCAAACTCGAGTTTGACTCTGGCAATCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014760
TATDN2 MISSION shRNA Bacterial Glycerol Stock
TatD DNase domain containing 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000307836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014760.3-1452s21c1
Sequence:CCGGCGAAGGACTGTCATTGACAAACTCGAGTTTGTCAATGACAGTCCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014760.3-2093s21c1
Sequence:CCGGGCTCTATTCCAAGCTATCTTTCTCGAGAAAGATAGCTTGGAATAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014760.3-2781s21c1
Sequence:CCGGCGAGAGATTGCCAGAGTCAAACTCGAGTTTGACTCTGGCAATCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014760.3-2435s21c1
Sequence:CCGGGCTGGCTGTGTCTCTAAAGAACTCGAGTTCTTTAGAGACACAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014760.3-940s21c1
Sequence:CCGGCCAACGCCTCTTTGGAAGAAACTCGAGTTTCTTCCAAAGAGGCGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014760
TATDN2 MISSION shRNA shRNA Plasmid DNA
TatD DNase domain containing 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000307836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014760.3-1452s21c1
Sequence:CCGGCGAAGGACTGTCATTGACAAACTCGAGTTTGTCAATGACAGTCCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014760.3-2093s21c1
Sequence:CCGGGCTCTATTCCAAGCTATCTTTCTCGAGAAAGATAGCTTGGAATAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014760.3-2781s21c1
Sequence:CCGGCGAGAGATTGCCAGAGTCAAACTCGAGTTTGACTCTGGCAATCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014760.3-2435s21c1
Sequence:CCGGGCTGGCTGTGTCTCTAAAGAACTCGAGTTCTTTAGAGACACAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014760.3-940s21c1
Sequence:CCGGCCAACGCCTCTTTGGAAGAAACTCGAGTTTCTTCCAAAGAGGCGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014760
TATDN2 MISSION shRNA Lentiviral Transduction Particles
TatD DNase domain containing 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000307836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014760.3-1452s21c1
Sequence:CCGGCGAAGGACTGTCATTGACAAACTCGAGTTTGTCAATGACAGTCCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014760.3-2093s21c1
Sequence:CCGGGCTCTATTCCAAGCTATCTTTCTCGAGAAAGATAGCTTGGAATAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014760.3-2781s21c1
Sequence:CCGGCGAGAGATTGCCAGAGTCAAACTCGAGTTTGACTCTGGCAATCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014760.3-2435s21c1
Sequence:CCGGGCTGGCTGTGTCTCTAAAGAACTCGAGTTCTTTAGAGACACAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014760.3-940s21c1
Sequence:CCGGCCAACGCCTCTTTGGAAGAAACTCGAGTTTCTTCCAAAGAGGCGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks