EMAIL THIS PAGE TO A FRIEND

TATDN3

TatD DNase domain containing 3

Gene ID:
Mouse(68972) TatD DNase domain containing 3
Rat(289378) TatD DNase domain containing 3
Zebrafish(553592) TatD DNase domain containing 3
domestic cat(101098764) TatD DNase domain containing 3
dog(490284) TatD DNase domain containing 3
chicken(421366) TatD DNase domain containing 3
domestic guinea pig(100721265) TatD DNase domain containing 3
cow(615965) TatD DNase domain containing 3
sheep(101114716) TatD DNase domain containing 3
127 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001042552 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001042552 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001042552 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_129661 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_129661 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_129661 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU103241 MISSION® esiRNA esiRNA human TATDN3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042552 Rosetta Predictions human pricing
NM_001042553 Rosetta Predictions human pricing
XM_375838 Rosetta Predictions human pricing
XM_931843 Rosetta Predictions human pricing
XM_931852 Rosetta Predictions human pricing
XM_931857 Rosetta Predictions human pricing
NM_001105987 Rosetta Predictions rat pricing
XM_213976 Rosetta Predictions rat pricing
XM_129661 Rosetta Predictions mouse pricing
XM_909966 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042552 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00310548 predicted 350
2 SASI_Hs02_00310549 predicted 417
3 SASI_Hs02_00310550 predicted 1006
4 SASI_Hs02_00310551 predicted 310
5 SASI_Hs02_00310552 predicted 323
6 SASI_Hs02_00310553 predicted 342
7 SASI_Hs02_00310554 predicted 444
8 SASI_Hs02_00310555 predicted 237
9 SASI_Hs02_00310556 predicted 1021
10 SASI_Hs02_00310557 predicted 326
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042553 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00310558 predicted 348
2 SASI_Hs02_00310559 predicted 413
3 SASI_Hs02_00310560 predicted 1004
4 SASI_Hs02_00310561 predicted 313
5 SASI_Hs02_00310562 predicted 323
6 SASI_Hs02_00310563 predicted 340
7 SASI_Hs02_00310564 predicted 447
8 SASI_Hs02_00310565 predicted 235
9 SASI_Hs02_00310566 predicted 1013
10 SASI_Hs02_00310567 predicted 326
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_375838 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00260189 predicted 417
2 SASI_Hs01_00260190 predicted 955
3 SASI_Hs01_00260191 predicted 760
4 SASI_Hs01_00260192 predicted 206
5 SASI_Hs01_00260193 predicted 335
6 SASI_Hs01_00260194 predicted 694
7 SASI_Hs01_00260195 predicted 448
8 SASI_Hs01_00260196 predicted 762
9 SASI_Hs01_00260197 predicted 617
10 SASI_Hs01_00260198 predicted 208
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931843 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00252849 predicted 352
2 SASI_Hs01_00252850 predicted 314
3 SASI_Hs01_00252851 predicted 203
4 SASI_Hs01_00252852 predicted 341
5 SASI_Hs01_00252853 predicted 230
6 SASI_Hs01_00252854 predicted 338
7 SASI_Hs01_00252855 predicted 317
8 SASI_Hs01_00252856 predicted 258
9 SASI_Hs01_00252857 predicted 271
10 SASI_Hs01_00252858 predicted 209
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931852 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00298743 predicted 410
2 SASI_Hs01_00298744 predicted 312
3 SASI_Hs01_00298745 predicted 355
4 SASI_Hs01_00298746 predicted 492
5 SASI_Hs01_00298747 predicted 340
6 SASI_Hs01_00298748 predicted 572
7 SASI_Hs01_00298749 predicted 449
8 SASI_Hs01_00298750 predicted 228
9 SASI_Hs01_00298751 predicted 463
10 SASI_Hs01_00298752 predicted 326
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931857 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00297262 predicted 417
2 SASI_Hs01_00297263 predicted 979
3 SASI_Hs01_00297264 predicted 781
4 SASI_Hs01_00297265 predicted 198
5 SASI_Hs01_00297266 predicted 334
6 SASI_Hs01_00297267 predicted 712
7 SASI_Hs01_00297268 predicted 444
8 SASI_Hs01_00297269 predicted 776
9 SASI_Hs01_00297270 predicted 623
10 SASI_Hs01_00297271 predicted 204
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105987 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00214512 predicted 805
2 SASI_Rn02_00214513 predicted 448
3 SASI_Rn02_00214514 predicted 232
4 SASI_Rn02_00214515 predicted 278
5 SASI_Rn02_00214516 predicted 410
6 SASI_Rn02_00214517 predicted 273
7 SASI_Rn02_00214518 predicted 588
8 SASI_Rn02_00214519 predicted 813
9 SASI_Rn02_00214520 predicted 408
10 SASI_Rn02_00214521 predicted 914
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_213976 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00190037 predicted 888
2 SASI_Rn01_00190038 predicted 880
3 SASI_Rn01_00190039 predicted 517
4 SASI_Rn01_00190040 predicted 823
5 SASI_Rn01_00190041 predicted 878
6 SASI_Rn01_00190042 predicted 297
7 SASI_Rn01_00190043 predicted 1007
8 SASI_Rn01_00190044 predicted 694
9 SASI_Rn01_00190045 predicted 328
10 SASI_Rn01_00190046 predicted 658
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_129661 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00250226 predicted 1000
2 SASI_Mm01_00250227 predicted 441
3 SASI_Mm01_00250228 predicted 326
4 SASI_Mm01_00250229 predicted 300
5 SASI_Mm01_00250230 predicted 338
6 SASI_Mm01_00250231 predicted 404
7 SASI_Mm01_00250232 predicted 660
8 SASI_Mm01_00250233 predicted 473
9 SASI_Mm01_00250234 predicted 774
10 SASI_Mm02_00424315 predicted 266
11 SASI_Mm01_00250225 predicted 213
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_909966 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00435250 predicted 1008
2 SASI_Mm02_00435251 predicted 445
3 SASI_Mm02_00435252 predicted 329
4 SASI_Mm02_00435253 predicted 297
5 SASI_Mm02_00435254 predicted 343
6 SASI_Mm02_00435255 predicted 403
7 SASI_Mm02_00435256 predicted 654
8 SASI_Mm02_00435257 predicted 477
9 SASI_Mm02_00435258 predicted 780
10 SASI_Mm02_00435259 predicted 265
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001042552
VALIDATED
TATDN3 MISSION shRNA Bacterial Glycerol Stock
TatD DNase domain containing 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000237933    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001042552.1-2181s21c1
Sequence:CCGGTGTACACTTATAACGAATTAGCTCGAGCTAATTCGTTATAAGTGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000237936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042552.1-196s21c1
Sequence:CCGGTGTGGCAGTTGCCGAACATTCCTCGAGGAATGTTCGGCAACTGCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000237935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001042552.1-698s21c1
Sequence:CCGGCAATTGCCTTTAACTTCTATACTCGAGTATAGAAGTTAAAGGCAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000237934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042552.1-847s21c1
Sequence:CCGGGACGACACAGAATGCATTAAACTCGAGTTTAATGCATTCTGTGTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000237937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001042552.1-344s21c1
Sequence:CCGGGATGTAGCTTTGCCCATTATTCTCGAGAATAATGGGCAAAGCTACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001042552
VALIDATED
TATDN3 MISSION shRNA shRNA Plasmid DNA
TatD DNase domain containing 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000237933    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001042552.1-2181s21c1
Sequence:CCGGTGTACACTTATAACGAATTAGCTCGAGCTAATTCGTTATAAGTGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000237936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042552.1-196s21c1
Sequence:CCGGTGTGGCAGTTGCCGAACATTCCTCGAGGAATGTTCGGCAACTGCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000237935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001042552.1-698s21c1
Sequence:CCGGCAATTGCCTTTAACTTCTATACTCGAGTATAGAAGTTAAAGGCAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000237934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042552.1-847s21c1
Sequence:CCGGGACGACACAGAATGCATTAAACTCGAGTTTAATGCATTCTGTGTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000237937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001042552.1-344s21c1
Sequence:CCGGGATGTAGCTTTGCCCATTATTCTCGAGAATAATGGGCAAAGCTACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001042552
VALIDATED
TATDN3 MISSION shRNA Lentiviral Transduction Particles
TatD DNase domain containing 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000237933    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001042552.1-2181s21c1
Sequence:CCGGTGTACACTTATAACGAATTAGCTCGAGCTAATTCGTTATAAGTGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000237936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042552.1-196s21c1
Sequence:CCGGTGTGGCAGTTGCCGAACATTCCTCGAGGAATGTTCGGCAACTGCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000237935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001042552.1-698s21c1
Sequence:CCGGCAATTGCCTTTAACTTCTATACTCGAGTATAGAAGTTAAAGGCAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000237934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042552.1-847s21c1
Sequence:CCGGGACGACACAGAATGCATTAAACTCGAGTTTAATGCATTCTGTGTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000237937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001042552.1-344s21c1
Sequence:CCGGGATGTAGCTTTGCCCATTATTCTCGAGAATAATGGGCAAAGCTACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_129661
TATDN3 MISSION shRNA Bacterial Glycerol Stock
TatD DNase domain containing 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000226165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_129661.10-482s21c1
Sequence:CCGGGGCTAAATGTGCCTCTAAATGCTCGAGCATTTAGAGGCACATTTAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226167    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_129661.10-1007s21c1
Sequence:CCGGTTACAGAAATGTTCCTCTTAACTCGAGTTAAGAGGAACATTTCTGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_129661.10-439s21c1
Sequence:GTACCGGGAACAAAGACAAGTCCTAATCCTCGAGGATTAGGACTTGTCTTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_129661.10-752s21c1
Sequence:CCGGGGAATGAACCCTGCAACATTTCTCGAGAAATGTTGCAGGGTTCATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_129661.10-330s21c1
Sequence:CCGGGGATGTAGCTTTGCCTATTATCTCGAGATAATAGGCAAAGCTACATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_129661
TATDN3 MISSION shRNA shRNA Plasmid DNA
TatD DNase domain containing 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000226165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_129661.10-482s21c1
Sequence:CCGGGGCTAAATGTGCCTCTAAATGCTCGAGCATTTAGAGGCACATTTAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226167    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_129661.10-1007s21c1
Sequence:CCGGTTACAGAAATGTTCCTCTTAACTCGAGTTAAGAGGAACATTTCTGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_129661.10-439s21c1
Sequence:GTACCGGGAACAAAGACAAGTCCTAATCCTCGAGGATTAGGACTTGTCTTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_129661.10-752s21c1
Sequence:CCGGGGAATGAACCCTGCAACATTTCTCGAGAAATGTTGCAGGGTTCATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_129661.10-330s21c1
Sequence:CCGGGGATGTAGCTTTGCCTATTATCTCGAGATAATAGGCAAAGCTACATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_129661
TATDN3 MISSION shRNA Lentiviral Transduction Particles
TatD DNase domain containing 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000226165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_129661.10-482s21c1
Sequence:CCGGGGCTAAATGTGCCTCTAAATGCTCGAGCATTTAGAGGCACATTTAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226167    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_129661.10-1007s21c1
Sequence:CCGGTTACAGAAATGTTCCTCTTAACTCGAGTTAAGAGGAACATTTCTGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_129661.10-439s21c1
Sequence:GTACCGGGAACAAAGACAAGTCCTAATCCTCGAGGATTAGGACTTGTCTTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_129661.10-752s21c1
Sequence:CCGGGGAATGAACCCTGCAACATTTCTCGAGAAATGTTGCAGGGTTCATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_129661.10-330s21c1
Sequence:CCGGGGATGTAGCTTTGCCTATTATCTCGAGATAATAGGCAAAGCTACATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks