EMAIL THIS PAGE TO A FRIEND

TAX1BP1

Tax1 (human T-cell leukemia virus type I) binding protein 1

Synonyms: CALCOCO3 T6BP TXBP151
Gene ID:
Human(8887) Summary: This gene encodes a HTLV-1 tax1 binding protein. The encoded protein interacts with TNFAIP3, and inhibits TNF-induced apoptosis by mediating the TNFAIP3 anti-apoptotic activity. Degradation of this protein by caspase-3-like family proteins is associated with apoptosis induced by TNF. This protein may also have a role in the inhibition of inflammatory signaling pathways. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, May 2011]
Mouse(52440) Tax1 (human T cell leukemia virus type I) binding protein 1
Rat(246244) Tax1 (human T-cell leukemia virus type I) binding protein 1
chicken(395490) Tax1 (human T-cell leukemia virus type I) binding protein 1
dog(475264) Tax1 (human T-cell leukemia virus type I) binding protein 1
Horse(100054756) Tax1 (human T-cell leukemia virus type I) binding protein 1
domestic cat(101080772) Tax1 (human T-cell leukemia virus type I) binding protein 1
cow(535589) Tax1 (human T-cell leukemia virus type I) binding protein 1
sheep(101103972) Tax1 (human T-cell leukemia virus type I) binding protein 1
domestic guinea pig(100732558) Tax1 (human T-cell leukemia virus type I) binding protein 1
naked mole-rat(101704862) Tax1 (human T-cell leukemia virus type I) binding protein 1
77 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006024 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006024 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006024 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025816 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025816 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025816 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001079864 Rosetta Predictions human pricing
NM_006024 Rosetta Predictions human pricing
NM_001004199 Rosetta Predictions rat pricing
NM_025816 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079864 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00313970 predicted 505
2 SASI_Hs02_00313971 predicted 650
3 SASI_Hs02_00313972 predicted 1258
4 SASI_Hs02_00313973 predicted 713
5 SASI_Hs02_00313974 predicted 958
6 SASI_Hs02_00313975 predicted 563
7 SASI_Hs02_00313976 predicted 1379
8 SASI_Hs02_00313977 predicted 265
9 SASI_Hs02_00313978 predicted 1659
10 SASI_Hs02_00313979 predicted 398
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006024 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00180971 predicted 514
2 SASI_Hs02_00340751 predicted 655
3 SASI_Hs01_00180972 predicted 1255
4 SASI_Hs02_00340752 predicted 716
5 SASI_Hs01_00180975 predicted 952
6 SASI_Hs01_00180976 predicted 562
7 SASI_Hs01_00180977 predicted 1385
8 SASI_Hs01_00180978 predicted 264
9 SASI_Hs01_00180979 predicted 1666
10 SASI_Hs02_00340753 predicted 406
11 SASI_Hs01_00180973 predicted 851
12 SASI_Hs01_00180974 predicted 1985
13 SASI_Hs01_00180980 predicted 746
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004199 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00113118 predicted 735
2 SASI_Rn02_00198165 predicted 1320
3 SASI_Rn02_00198166 predicted 885
4 SASI_Rn01_00113120 predicted 221
5 SASI_Rn01_00113121 predicted 2192
6 SASI_Rn01_00113122 predicted 985
7 SASI_Rn02_00198167 predicted 2366
8 SASI_Rn01_00113123 predicted 410
9 SASI_Rn01_00113124 predicted 1921
10 SASI_Rn01_00113125 predicted 1753
11 SASI_Rn01_00113119 predicted 2514
12 SASI_Rn01_00113126 predicted 337
13 SASI_Rn01_00113127 predicted 1202
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025816 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00096965 predicted 2552
2 SASI_Mm01_00096966 predicted 247
3 SASI_Mm01_00096967 predicted 760
4 SASI_Mm01_00096969 predicted 1568
5 SASI_Mm01_00096970 predicted 312
6 SASI_Mm02_00329065 predicted 357
7 SASI_Mm01_00096971 predicted 2609
8 SASI_Mm01_00096972 predicted 1952
9 SASI_Mm01_00096973 predicted 2413
10 SASI_Mm01_00096974 predicted 216
11 SASI_Mm01_00096968 predicted 778
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006024
VALIDATED
TAX1BP1 MISSION shRNA Bacterial Glycerol Stock
Tax1 (human T-cell leukemia virus type I) binding protein 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353684    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_006024.5-2967s21c1
Sequence:CCGGTGAAGTAGTTCTTCGAATATACTCGAGTATATTCGAAGAACTACTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_006024.5-1557s21c1
Sequence:CCGGTCAGATCAATCAGCTAATAATCTCGAGATTATTAGCTGATTGATCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_006024.5-328s21c1
Sequence:CCGGGGAGTACTGCTCGTGATTATTCTCGAGAATAATCACGAGCAGTACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_006024.5-263s21c1
Sequence:CCGGTTACACCTTAACTCCATATATCTCGAGATATATGGAGTTAAGGTGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_006024.5-942s21c1
Sequence:CCGGGCACAACATGAAAGAGAACAACTCGAGTTGTTCTCTTTCATGTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130449    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006024.4-2622s1c1
Sequence:CCGGGTCAGTCTTTGGCTTATCAATCTCGAGATTGATAAGCCAAAGACTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006024.4-401s1c1
Sequence:CCGGGTTACCCATAAGGGTGAAATTCTCGAGAATTTCACCCTTATGGGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_006024.4-266s1c1
Sequence:CCGGGCTCGTGATTATTACACGTTTCTCGAGAAACGTGTAATAATCACGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006024.4-872s1c1
Sequence:CCGGGCACAACATGAAAGAGAACAACTCGAGTTGTTCTCTTTCATGTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149268    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006024.4-2550s1c1
Sequence:CCGGGATGCTTTCATGCACCCTTTACTCGAGTAAAGGGTGCATGAAAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147602    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_006024.4-2823s1c1
Sequence:CCGGGTTTCTGTTGACCTTGTTGATCTCGAGATCAACAAGGTCAACAGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148051    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_006024.4-2590s1c1
Sequence:CCGGGCTACTTTGAGTTTGGTGTTACTCGAGTAACACCAAACTCAAAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006024
VALIDATED
TAX1BP1 MISSION shRNA shRNA Plasmid DNA
Tax1 (human T-cell leukemia virus type I) binding protein 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353684    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_006024.5-2967s21c1
Sequence:CCGGTGAAGTAGTTCTTCGAATATACTCGAGTATATTCGAAGAACTACTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_006024.5-1557s21c1
Sequence:CCGGTCAGATCAATCAGCTAATAATCTCGAGATTATTAGCTGATTGATCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_006024.5-328s21c1
Sequence:CCGGGGAGTACTGCTCGTGATTATTCTCGAGAATAATCACGAGCAGTACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_006024.5-263s21c1
Sequence:CCGGTTACACCTTAACTCCATATATCTCGAGATATATGGAGTTAAGGTGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_006024.5-942s21c1
Sequence:CCGGGCACAACATGAAAGAGAACAACTCGAGTTGTTCTCTTTCATGTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130449    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006024.4-2622s1c1
Sequence:CCGGGTCAGTCTTTGGCTTATCAATCTCGAGATTGATAAGCCAAAGACTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006024.4-401s1c1
Sequence:CCGGGTTACCCATAAGGGTGAAATTCTCGAGAATTTCACCCTTATGGGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_006024.4-266s1c1
Sequence:CCGGGCTCGTGATTATTACACGTTTCTCGAGAAACGTGTAATAATCACGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006024.4-872s1c1
Sequence:CCGGGCACAACATGAAAGAGAACAACTCGAGTTGTTCTCTTTCATGTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149268    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006024.4-2550s1c1
Sequence:CCGGGATGCTTTCATGCACCCTTTACTCGAGTAAAGGGTGCATGAAAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147602    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_006024.4-2823s1c1
Sequence:CCGGGTTTCTGTTGACCTTGTTGATCTCGAGATCAACAAGGTCAACAGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148051    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_006024.4-2590s1c1
Sequence:CCGGGCTACTTTGAGTTTGGTGTTACTCGAGTAACACCAAACTCAAAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006024
VALIDATED
TAX1BP1 MISSION shRNA Lentiviral Transduction Particles
Tax1 (human T-cell leukemia virus type I) binding protein 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353684    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_006024.5-2967s21c1
Sequence:CCGGTGAAGTAGTTCTTCGAATATACTCGAGTATATTCGAAGAACTACTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_006024.5-1557s21c1
Sequence:CCGGTCAGATCAATCAGCTAATAATCTCGAGATTATTAGCTGATTGATCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_006024.5-328s21c1
Sequence:CCGGGGAGTACTGCTCGTGATTATTCTCGAGAATAATCACGAGCAGTACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_006024.5-263s21c1
Sequence:CCGGTTACACCTTAACTCCATATATCTCGAGATATATGGAGTTAAGGTGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_006024.5-942s21c1
Sequence:CCGGGCACAACATGAAAGAGAACAACTCGAGTTGTTCTCTTTCATGTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130449    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006024.4-2622s1c1
Sequence:CCGGGTCAGTCTTTGGCTTATCAATCTCGAGATTGATAAGCCAAAGACTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006024.4-401s1c1
Sequence:CCGGGTTACCCATAAGGGTGAAATTCTCGAGAATTTCACCCTTATGGGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_006024.4-266s1c1
Sequence:CCGGGCTCGTGATTATTACACGTTTCTCGAGAAACGTGTAATAATCACGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006024.4-872s1c1
Sequence:CCGGGCACAACATGAAAGAGAACAACTCGAGTTGTTCTCTTTCATGTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149268    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006024.4-2550s1c1
Sequence:CCGGGATGCTTTCATGCACCCTTTACTCGAGTAAAGGGTGCATGAAAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147602    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_006024.4-2823s1c1
Sequence:CCGGGTTTCTGTTGACCTTGTTGATCTCGAGATCAACAAGGTCAACAGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148051    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_006024.4-2590s1c1
Sequence:CCGGGCTACTTTGAGTTTGGTGTTACTCGAGTAACACCAAACTCAAAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025816
VALIDATED
TAX1BP1 MISSION shRNA Bacterial Glycerol Stock
Tax1 (human T-cell leukemia virus type I) binding protein 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000219583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_025816.2-1252s1c1
Sequence:CCGGTGCAGTGAATGTGCGAGATAACTCGAGTTATCTCGCACATTCACTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200219    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025816.1-428s1c1
Sequence:CCGGCGTCACCCATAAGGGTGAAATCTCGAGATTTCACCCTTATGGGTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_025816.1-417s1c1
Sequence:CCGGCAGTTCTGTTACGTCACCCATCTCGAGATGGGTGACGTAACAGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198119    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_025816.1-2664s1c1
Sequence:CCGGCCTGATGATGGAGAACTTCTTCTCGAGAAGAAGTTCTCCATCATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_025816.1-294s1c1
Sequence:CCGGGCTCGTGACTATTACACATTTCTCGAGAAATGTGTAATAGTCACGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025816.1-218s1c1
Sequence:CCGGCCATTACACCTTAACTCCGTACTCGAGTACGGAGTTAAGGTGTAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177399    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025816.1-2716s1c1
Sequence:CCGGGCTGTGACTACATACAATGAACTCGAGTTCATTGTATGTAGTCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177084    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025816.1-2751s1c1
Sequence:CCGGCTGTTAATCTTGTCTGCTGTACTCGAGTACAGCAGACAAGATTAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025816.1-730s1c1
Sequence:CCGGGCCTTCTTGAAGTATCACAAACTCGAGTTTGTGATACTTCAAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025816.1-2356s1c1
Sequence:CCGGCCAGCTTTGATGTTCACAAGACTCGAGTCTTGTGAACATCAAAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025816
VALIDATED
TAX1BP1 MISSION shRNA shRNA Plasmid DNA
Tax1 (human T-cell leukemia virus type I) binding protein 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000219583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_025816.2-1252s1c1
Sequence:CCGGTGCAGTGAATGTGCGAGATAACTCGAGTTATCTCGCACATTCACTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200219    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025816.1-428s1c1
Sequence:CCGGCGTCACCCATAAGGGTGAAATCTCGAGATTTCACCCTTATGGGTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_025816.1-417s1c1
Sequence:CCGGCAGTTCTGTTACGTCACCCATCTCGAGATGGGTGACGTAACAGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198119    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_025816.1-2664s1c1
Sequence:CCGGCCTGATGATGGAGAACTTCTTCTCGAGAAGAAGTTCTCCATCATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_025816.1-294s1c1
Sequence:CCGGGCTCGTGACTATTACACATTTCTCGAGAAATGTGTAATAGTCACGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025816.1-218s1c1
Sequence:CCGGCCATTACACCTTAACTCCGTACTCGAGTACGGAGTTAAGGTGTAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177399    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025816.1-2716s1c1
Sequence:CCGGGCTGTGACTACATACAATGAACTCGAGTTCATTGTATGTAGTCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177084    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025816.1-2751s1c1
Sequence:CCGGCTGTTAATCTTGTCTGCTGTACTCGAGTACAGCAGACAAGATTAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025816.1-730s1c1
Sequence:CCGGGCCTTCTTGAAGTATCACAAACTCGAGTTTGTGATACTTCAAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025816.1-2356s1c1
Sequence:CCGGCCAGCTTTGATGTTCACAAGACTCGAGTCTTGTGAACATCAAAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025816
VALIDATED
TAX1BP1 MISSION shRNA Lentiviral Transduction Particles
Tax1 (human T-cell leukemia virus type I) binding protein 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000219583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_025816.2-1252s1c1
Sequence:CCGGTGCAGTGAATGTGCGAGATAACTCGAGTTATCTCGCACATTCACTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200219    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025816.1-428s1c1
Sequence:CCGGCGTCACCCATAAGGGTGAAATCTCGAGATTTCACCCTTATGGGTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_025816.1-417s1c1
Sequence:CCGGCAGTTCTGTTACGTCACCCATCTCGAGATGGGTGACGTAACAGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198119    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_025816.1-2664s1c1
Sequence:CCGGCCTGATGATGGAGAACTTCTTCTCGAGAAGAAGTTCTCCATCATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_025816.1-294s1c1
Sequence:CCGGGCTCGTGACTATTACACATTTCTCGAGAAATGTGTAATAGTCACGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025816.1-218s1c1
Sequence:CCGGCCATTACACCTTAACTCCGTACTCGAGTACGGAGTTAAGGTGTAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177399    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025816.1-2716s1c1
Sequence:CCGGGCTGTGACTACATACAATGAACTCGAGTTCATTGTATGTAGTCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177084    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025816.1-2751s1c1
Sequence:CCGGCTGTTAATCTTGTCTGCTGTACTCGAGTACAGCAGACAAGATTAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025816.1-730s1c1
Sequence:CCGGGCCTTCTTGAAGTATCACAAACTCGAGTTTGTGATACTTCAAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025816.1-2356s1c1
Sequence:CCGGCCAGCTTTGATGTTCACAAGACTCGAGTCTTGTGAACATCAAAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks