EMAIL THIS PAGE TO A FRIEND

TAZ

tafazzin

Synonyms: BTHS CMD3A EFE EFE2 G4.5 LVNCX Taz1
Gene ID:
Human(6901) Summary: This gene encodes a protein that is expressed at high levels in cardiac and skeletal muscle. Mutations in this gene have been associated with a number of clinical disorders including Barth syndrome, dilated cardiomyopathy (DCM), hypertrophic DCM, endocardial fibroelastosis, and left ventricular noncompaction (LVNC). Multiple transcript variants encoding different isoforms have been described. A long form and a short form of each of these isoforms is produced; the short form lacks a hydrophobic leader sequence and may exist as a cytoplasmic protein rather than being membrane-bound. Other alternatively spliced transcripts have been described but the full-length nature of all these transcripts is not known. [provided by RefSeq, Jul 2008]
Mouse(66826) tafazzin
Rat(363521) tafazzin
fruit fly(36405) Tafazzin
dog(612975) tafazzin
cow(515177) tafazzin
sheep(101108456) tafazzin
104 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2501013 Anti-Tafazzin antibody produced in goat affinity isolated antibody, buffered aqueous solution human, mouse, canine, rat
ELISA, western blot pricing
HPA039557 Anti-TAZ antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
WH0006901M12 Monoclonal Anti-TAZ antibody produced in mouse clone 1B10, purified immunoglobulin, buffered aqueous solution rat, mouse, human
ELISA, western blot pricing
SAB1404443 Monoclonal Anti-TAZ antibody produced in mouse clone 1F11, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1409717 Monoclonal Anti-TAZ antibody produced in mouse clone 3A12, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1409718 Monoclonal Anti-TAZ antibody produced in mouse clone 2B3, purified immunoglobulin, buffered aqueous solution human, rat
ELISA, western blot pricing
SAB1409719 Monoclonal Anti-TAZ antibody produced in mouse clone 3A11, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1409720 Monoclonal Anti-TAZ antibody produced in mouse clone 1A4, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1409721 Monoclonal Anti-TAZ antibody produced in mouse clone 3C10, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence pricing
SAB1409722 Monoclonal Anti-TAZ antibody produced in mouse clone 1E5, purified immunoglobulin, buffered aqueous solution human
ELISA pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000116 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000116 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000116 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_181516 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_181516 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_181516 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000116 Rosetta Predictions human pricing
NM_181311 Rosetta Predictions human pricing
NM_181312 Rosetta Predictions human pricing
NM_181313 Rosetta Predictions human pricing
NM_181314 Rosetta Predictions human pricing
NM_001025748 Rosetta Predictions rat pricing
NM_181516 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000116 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00025787 predicted 1397
2 SASI_Hs02_00301900 predicted 1095
3 SASI_Hs01_00025788 predicted 1328
4 SASI_Hs01_00025789 predicted 1527
5 SASI_Hs01_00025790 predicted 1113
6 SASI_Hs02_00301901 predicted 1100
7 SASI_Hs01_00025791 predicted 1088
8 SASI_Hs01_00025792 predicted 1344
9 SASI_Hs01_00025793 predicted 1172
10 SASI_Hs01_00025794 predicted 1479
11 SASI_Hs01_00025795 predicted 1672
12 SASI_Hs01_00025796 predicted 1587
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181311 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00219012 predicted 1309
2 SASI_Hs02_00369984 predicted 1004
3 SASI_Hs01_00219013 predicted 1238
4 SASI_Hs01_00219014 predicted 1437
5 SASI_Hs01_00219015 predicted 1024
6 SASI_Hs02_00369985 predicted 1010
7 SASI_Hs01_00219016 predicted 996
8 SASI_Hs01_00219017 predicted 1260
9 SASI_Hs01_00219018 predicted 1081
10 SASI_Hs01_00219019 predicted 1382
11 SASI_Hs01_00219020 predicted 1582
12 SASI_Hs01_00219021 predicted 1495
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181312 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00157481 predicted 1357
2 SASI_Hs02_00369986 predicted 1055
3 SASI_Hs01_00157482 predicted 1289
4 SASI_Hs01_00157483 predicted 1491
5 SASI_Hs01_00157484 predicted 1069
6 SASI_Hs02_00369987 predicted 1053
7 SASI_Hs01_00157485 predicted 1039
8 SASI_Hs01_00157486 predicted 1305
9 SASI_Hs01_00157487 predicted 1122
10 SASI_Hs01_00157488 predicted 1429
11 SASI_Hs01_00157489 predicted 1632
12 SASI_Hs01_00157490 predicted 1551
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181313 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00028898 predicted 1263
2 SASI_Hs02_00369988 predicted 967
3 SASI_Hs01_00028899 predicted 1195
4 SASI_Hs01_00028900 predicted 1395
5 SASI_Hs01_00028901 predicted 980
6 SASI_Hs02_00369989 predicted 967
7 SASI_Hs01_00028902 predicted 952
8 SASI_Hs01_00028903 predicted 1214
9 SASI_Hs01_00028904 predicted 1038
10 SASI_Hs01_00028905 predicted 1345
11 SASI_Hs01_00028906 predicted 1540
12 SASI_Hs01_00028907 predicted 1452
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181314 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00096234 predicted 847
2 SASI_Hs01_00096235 predicted 911
3 SASI_Hs01_00096236 predicted 881
4 SASI_Hs01_00096237 predicted 420
5 SASI_Hs01_00096238 predicted 868
6 SASI_Hs01_00096239 predicted 558
7 SASI_Hs01_00096240 predicted 882
8 SASI_Hs01_00096241 predicted 775
9 SASI_Hs01_00096242 predicted 961
10 SASI_Hs01_00096243 predicted 728
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025748 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00120266 predicted 712
2 SASI_Rn01_00120267 predicted 431
3 SASI_Rn01_00120269 predicted 1210
4 SASI_Rn01_00120270 predicted 741
5 SASI_Rn01_00120271 predicted 351
6 SASI_Rn01_00120272 predicted 1179
7 SASI_Rn01_00120273 predicted 1152
8 SASI_Rn01_00120274 predicted 780
9 SASI_Rn02_00203407 predicted 1216
10 SASI_Rn02_00203408 predicted 361
11 SASI_Rn01_00120265 predicted 1299
12 SASI_Rn01_00120268 predicted 620
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181516 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00176456 predicted 619
2 SASI_Mm01_00176457 predicted 709
3 SASI_Mm01_00176458 predicted 707
4 SASI_Mm01_00176459 predicted 1147
5 SASI_Mm02_00349792 predicted 1053
6 SASI_Mm01_00176460 predicted 996
7 SASI_Mm01_00176461 predicted 946
8 SASI_Mm01_00176462 predicted 1120
9 SASI_Mm01_00176464 predicted 1203
10 SASI_Mm01_00176465 predicted 1206
11 SASI_Mm01_00176463 predicted 748
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000116
VALIDATED
TAZ MISSION shRNA Bacterial Glycerol Stock
tafazzin
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000310303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000116.3-544s21c1
Sequence:CCGGGATCCTGAAACTCCGCCACATCTCGAGATGTGGCGGAGTTTCAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_000116.3-452s21c1
Sequence:CCGGCTGTACGAGCTCATCGAGAAGCTCGAGCTTCTCGATGAGCTCGTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000116.3-967s21c1
Sequence:CCGGTCCTAACAGTCCGCCCTACTTCTCGAGAAGTAGGGCGGACTGTTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296572    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000116.3-1337s21c1
Sequence:CCGGTGCTTCCTCAGTTACACAAAGCTCGAGCTTTGTGTAACTGAGGAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_000116.3-1104s21c1
Sequence:CCGGCGGACTTCATTCAAGAGGAATCTCGAGATTCCTCTTGAATGAAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083053    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000116.2-1416s1c1
Sequence:CCGGCTTTCCTTCTTGCCTTCAGATCTCGAGATCTGAAGGCAAGAAGGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000116.2-1103s1c1
Sequence:CCGGCGGACTTCATTCAAGAGGAATCTCGAGATTCCTCTTGAATGAAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_000116.2-410s1c1
Sequence:CCGGCCAAGTACATGAACCACCTGACTCGAGTCAGGTGGTTCATGTACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000116.2-937s1c1
Sequence:CCGGCTGTGGCATGTCGGAATGAATCTCGAGATTCATTCCGACATGCCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000116.2-849s1c1
Sequence:CCGGAGTGAACATGAGTTCCGAATTCTCGAGAATTCGGAACTCATGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000116
VALIDATED
TAZ MISSION shRNA shRNA Plasmid DNA
tafazzin
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000310303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000116.3-544s21c1
Sequence:CCGGGATCCTGAAACTCCGCCACATCTCGAGATGTGGCGGAGTTTCAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_000116.3-452s21c1
Sequence:CCGGCTGTACGAGCTCATCGAGAAGCTCGAGCTTCTCGATGAGCTCGTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000116.3-967s21c1
Sequence:CCGGTCCTAACAGTCCGCCCTACTTCTCGAGAAGTAGGGCGGACTGTTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296572    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000116.3-1337s21c1
Sequence:CCGGTGCTTCCTCAGTTACACAAAGCTCGAGCTTTGTGTAACTGAGGAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_000116.3-1104s21c1
Sequence:CCGGCGGACTTCATTCAAGAGGAATCTCGAGATTCCTCTTGAATGAAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083053    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000116.2-1416s1c1
Sequence:CCGGCTTTCCTTCTTGCCTTCAGATCTCGAGATCTGAAGGCAAGAAGGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000116.2-1103s1c1
Sequence:CCGGCGGACTTCATTCAAGAGGAATCTCGAGATTCCTCTTGAATGAAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_000116.2-410s1c1
Sequence:CCGGCCAAGTACATGAACCACCTGACTCGAGTCAGGTGGTTCATGTACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000116.2-937s1c1
Sequence:CCGGCTGTGGCATGTCGGAATGAATCTCGAGATTCATTCCGACATGCCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000116.2-849s1c1
Sequence:CCGGAGTGAACATGAGTTCCGAATTCTCGAGAATTCGGAACTCATGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000116
VALIDATED
TAZ MISSION shRNA Lentiviral Transduction Particles
tafazzin
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000310303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000116.3-544s21c1
Sequence:CCGGGATCCTGAAACTCCGCCACATCTCGAGATGTGGCGGAGTTTCAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_000116.3-452s21c1
Sequence:CCGGCTGTACGAGCTCATCGAGAAGCTCGAGCTTCTCGATGAGCTCGTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000116.3-967s21c1
Sequence:CCGGTCCTAACAGTCCGCCCTACTTCTCGAGAAGTAGGGCGGACTGTTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296572    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000116.3-1337s21c1
Sequence:CCGGTGCTTCCTCAGTTACACAAAGCTCGAGCTTTGTGTAACTGAGGAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_000116.3-1104s21c1
Sequence:CCGGCGGACTTCATTCAAGAGGAATCTCGAGATTCCTCTTGAATGAAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083053    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000116.2-1416s1c1
Sequence:CCGGCTTTCCTTCTTGCCTTCAGATCTCGAGATCTGAAGGCAAGAAGGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000116.2-1103s1c1
Sequence:CCGGCGGACTTCATTCAAGAGGAATCTCGAGATTCCTCTTGAATGAAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_000116.2-410s1c1
Sequence:CCGGCCAAGTACATGAACCACCTGACTCGAGTCAGGTGGTTCATGTACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000116.2-937s1c1
Sequence:CCGGCTGTGGCATGTCGGAATGAATCTCGAGATTCATTCCGACATGCCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000116.2-849s1c1
Sequence:CCGGAGTGAACATGAGTTCCGAATTCTCGAGAATTCGGAACTCATGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181516
VALIDATED
TAZ MISSION shRNA Bacterial Glycerol Stock
tafazzin
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000121047    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181516.2-1590s1c1
Sequence:CCGGCCAGGATTCAAGCACAGCTAACTCGAGTTAGCTGTGCTTGAATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181516.2-571s1c1
Sequence:CCGGGCACTCCCATTTCTTCAGCTTCTCGAGAAGCTGAAGAAATGGGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181516.2-380s1c1
Sequence:CCGGCACAACAAGGAAGTGCTGTATCTCGAGATACAGCACTTCCTTGTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181516.2-691s1c1
Sequence:CCGGCCCAGAAGGGAAAGTAAACATCTCGAGATGTTTACTTTCCCTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181516.2-998s1c1
Sequence:CCGGGCAGAACAGCTCCACAATCATCTCGAGATGATTGTGGAGCTGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181516
VALIDATED
TAZ MISSION shRNA shRNA Plasmid DNA
tafazzin
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000121047    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181516.2-1590s1c1
Sequence:CCGGCCAGGATTCAAGCACAGCTAACTCGAGTTAGCTGTGCTTGAATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181516.2-571s1c1
Sequence:CCGGGCACTCCCATTTCTTCAGCTTCTCGAGAAGCTGAAGAAATGGGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181516.2-380s1c1
Sequence:CCGGCACAACAAGGAAGTGCTGTATCTCGAGATACAGCACTTCCTTGTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181516.2-691s1c1
Sequence:CCGGCCCAGAAGGGAAAGTAAACATCTCGAGATGTTTACTTTCCCTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181516.2-998s1c1
Sequence:CCGGGCAGAACAGCTCCACAATCATCTCGAGATGATTGTGGAGCTGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181516
VALIDATED
TAZ MISSION shRNA Lentiviral Transduction Particles
tafazzin
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000121047    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181516.2-1590s1c1
Sequence:CCGGCCAGGATTCAAGCACAGCTAACTCGAGTTAGCTGTGCTTGAATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181516.2-571s1c1
Sequence:CCGGGCACTCCCATTTCTTCAGCTTCTCGAGAAGCTGAAGAAATGGGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181516.2-380s1c1
Sequence:CCGGCACAACAAGGAAGTGCTGTATCTCGAGATACAGCACTTCCTTGTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181516.2-691s1c1
Sequence:CCGGCCCAGAAGGGAAAGTAAACATCTCGAGATGTTTACTTTCCCTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181516.2-998s1c1
Sequence:CCGGGCAGAACAGCTCCACAATCATCTCGAGATGATTGTGGAGCTGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks