EMAIL THIS PAGE TO A FRIEND

TBATA

thymus, brain and testes associated

Synonyms: C10orf27 spatial
UniProtKB ID: Q96M53, A4QPA8, B2RPQ2, Q5T4G2
Gene ID:
Mouse(65971) thymus, brain and testes associated
Rat(499429) thymus, brain and testes associated
Zebrafish(557892) thymus, brain and testes associated
domestic cat(101100671) thymus, brain and testes associated
dog(609672) thymus, brain and testes associated
cow(515913) chromosome 28 open reading frame, human C10orf27
sheep(101106567) thymus, brain and testes associated
naked mole-rat(101718546) thymus, brain and testes associated
domestic guinea pig(100722274) thymus, brain and testes associated
140 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152710 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152710 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152710 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023064 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023064 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023064 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU049721 MISSION® esiRNA esiRNA human C10orf27 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152710 Rosetta Predictions human pricing
XM_001055117 Rosetta Predictions rat pricing
XM_574753 Rosetta Predictions rat pricing
NM_001017407 Rosetta Predictions mouse pricing
NM_001017409 Rosetta Predictions mouse pricing
NM_001017419 Rosetta Predictions mouse pricing
NM_001017433 Rosetta Predictions mouse pricing
NM_001017441 Rosetta Predictions mouse pricing
NM_023064 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152710 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00366608 predicted 680
2 SASI_Hs02_00366609 predicted 926
3 SASI_Hs01_00028653 predicted 765
4 SASI_Hs01_00028654 predicted 515
5 SASI_Hs01_00028655 predicted 1145
6 SASI_Hs01_00028657 predicted 1119
7 SASI_Hs01_00028658 predicted 1111
8 SASI_Hs01_00028659 predicted 937
9 SASI_Hs01_00028660 predicted 592
10 SASI_Hs01_00028661 predicted 822
11 SASI_Hs01_00028656 predicted 1250
12 SASI_Hs01_00028662 predicted 1247
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055117 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00278502 predicted 668
2 SASI_Rn02_00278503 predicted 967
3 SASI_Rn02_00278504 predicted 524
4 SASI_Rn02_00278505 predicted 598
5 SASI_Rn02_00278506 predicted 483
6 SASI_Rn02_00278507 predicted 1199
7 SASI_Rn02_00278508 predicted 1093
8 SASI_Rn02_00278509 predicted 933
9 SASI_Rn02_00278510 predicted 493
10 SASI_Rn02_00278511 predicted 727
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574753 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00402484 predicted 528
2 SASI_Rn02_00402485 predicted 593
3 SASI_Rn02_00402486 predicted 482
4 SASI_Rn02_00402487 predicted 511
5 SASI_Rn02_00402488 predicted 569
6 SASI_Rn02_00402489 predicted 485
7 SASI_Rn02_00402490 predicted 571
8 SASI_Rn02_00402491 predicted 528
9 SASI_Rn02_00402492 predicted 476
10 SASI_Rn02_00402493 predicted 490
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017407 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00287484 predicted 432
2 SASI_Mm02_00287485 predicted 502
3 SASI_Mm01_00081240 predicted 396
4 SASI_Mm02_00287486 predicted 807
5 SASI_Mm02_00287487 predicted 213
6 SASI_Mm02_00287488 predicted 612
7 SASI_Mm01_00081243 predicted 315
8 SASI_Mm02_00287489 predicted 133
9 SASI_Mm02_00287490 predicted 226
10 SASI_Mm02_00287491 predicted 216
11 SASI_Mm01_00081241 predicted 327
12 SASI_Mm01_00081242 predicted 370
13 SASI_Mm01_00081244 predicted 307
14 SASI_Mm01_00081245 predicted 368
15 SASI_Mm01_00081246 predicted 305
16 SASI_Mm01_00081247 predicted 325
17 SASI_Mm01_00081248 predicted 376
18 SASI_Mm01_00081249 predicted 419
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017409 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00287492 predicted 330
2 SASI_Mm01_00178591 predicted 317
3 SASI_Mm02_00287493 predicted 302
4 SASI_Mm02_00287494 predicted 302
5 SASI_Mm02_00287495 predicted 291
6 SASI_Mm02_00287496 predicted 320
7 SASI_Mm02_00287497 predicted 310
8 SASI_Mm02_00287498 predicted 303
9 SASI_Mm02_00287499 predicted 301
10 SASI_Mm02_00287500 predicted 312
11 SASI_Mm01_00178585 predicted 438
12 SASI_Mm01_00178586 predicted 509
13 SASI_Mm01_00178587 predicted 411
14 SASI_Mm01_00178588 predicted 885
15 SASI_Mm01_00178589 predicted 216
16 SASI_Mm01_00178590 predicted 683
17 SASI_Mm01_00178592 predicted 137
18 SASI_Mm01_00178593 predicted 235
19 SASI_Mm01_00178594 predicted 218
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017419 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00088657 predicted 722
2 SASI_Mm01_00088658 predicted 925
3 SASI_Mm01_00088660 predicted 931
4 SASI_Mm01_00088661 predicted 1164
5 SASI_Mm01_00088662 predicted 1075
6 SASI_Mm01_00088663 predicted 1066
7 SASI_Mm01_00088665 predicted 760
8 SASI_Mm01_00088666 predicted 768
9 SASI_Mm02_00287501 predicted 672
10 SASI_Mm02_00287502 predicted 1070
11 SASI_Mm01_00088659 predicted 1043
12 SASI_Mm01_00088664 predicted 1172
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017433 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00072364 predicted 832
2 SASI_Mm01_00072365 predicted 1036
3 SASI_Mm01_00072367 predicted 1042
4 SASI_Mm01_00072368 predicted 1267
5 SASI_Mm01_00072369 predicted 1181
6 SASI_Mm01_00072370 predicted 1168
7 SASI_Mm01_00072372 predicted 870
8 SASI_Mm01_00072373 predicted 869
9 SASI_Mm02_00287508 predicted 766
10 SASI_Mm02_00287509 predicted 1171
11 SASI_Mm01_00072366 predicted 1145
12 SASI_Mm01_00072371 predicted 1273
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017441 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00287510 predicted 478
2 SASI_Mm02_00287511 predicted 505
3 SASI_Mm02_00287512 predicted 441
4 SASI_Mm01_00126670 predicted 445
5 SASI_Mm02_00287513 predicted 451
6 SASI_Mm01_00126678 predicted 453
7 SASI_Mm02_00287514 predicted 453
8 SASI_Mm02_00287515 predicted 481
9 SASI_Mm02_00287516 predicted 499
10 SASI_Mm02_00287517 predicted 456
11 SASI_Mm01_00126669 predicted 328
12 SASI_Mm01_00126671 predicted 322
13 SASI_Mm01_00126672 predicted 310
14 SASI_Mm01_00126673 predicted 372
15 SASI_Mm01_00126674 predicted 303
16 SASI_Mm01_00126675 predicted 330
17 SASI_Mm01_00126676 predicted 379
18 SASI_Mm01_00126677 predicted 371
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023064 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00326781 predicted 543
2 SASI_Mm02_00326782 predicted 608
3 SASI_Mm02_00326783 predicted 499
4 SASI_Mm02_00326784 predicted 907
5 SASI_Mm02_00326785 predicted 214
6 SASI_Mm02_00326786 predicted 706
7 SASI_Mm01_00189336 predicted 322
8 SASI_Mm01_00189338 predicted 365
9 SASI_Mm02_00326787 predicted 128
10 SASI_Mm02_00326788 predicted 229
11 SASI_Mm01_00189334 predicted 335
12 SASI_Mm01_00189335 predicted 365
13 SASI_Mm01_00189337 predicted 312
14 SASI_Mm01_00189339 predicted 300
15 SASI_Mm01_00189340 predicted 324
16 SASI_Mm01_00189341 predicted 378
17 SASI_Mm01_00189342 predicted 374
18 SASI_Mm01_00189343 predicted 370
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152710
TBATA MISSION shRNA Bacterial Glycerol Stock
thymus, brain and testes associated
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152710.1-502s1c1
Sequence:CCGGCAGAAAGAACTGGTGATCCCACTCGAGTGGGATCACCAGTTCTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152710.1-870s1c1
Sequence:CCGGCAAGGAGGATGAACTGAAGAACTCGAGTTCTTCAGTTCATCCTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152710.1-1264s1c1
Sequence:CCGGGAAGTGCATGAACCTCCTCAACTCGAGTTGAGGAGGTTCATGCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161655    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152710.1-1360s1c1
Sequence:CCGGGAGTACATTGGAGAAGCTCAACTCGAGTTGAGCTTCTCCAATGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152710.1-1386s1c1
Sequence:CCGGCCAGATGCATTCAAGCCAGAACTCGAGTTCTGGCTTGAATGCATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152710.1-714s1c1
Sequence:CCGGCTTGCCTGAGTCAACTGTCTTCTCGAGAAGACAGTTGACTCAGGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135388    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152710.1-888s1c1
Sequence:CCGGGAAGAAAGAGAAGGAGCAGAACTCGAGTTCTGCTCCTTCTCTTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135817    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152710.1-1407s1c1
Sequence:CCGGCACAGAGAAGAAGACATCGAACTCGAGTTCGATGTCTTCTTCTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152710.2-649s21c1
Sequence:CCGGCACGTGACCCACATCCAAGATCTCGAGATCTTGGATGTGGGTCACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152710.2-604s21c1
Sequence:CCGGCTCAGTCACCACTCCTTCTTCCTCGAGGAAGAAGGAGTGGTGACTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152710.2-1111s21c1
Sequence:CCGGACAGACTTGCTAAGCGCAATCCTCGAGGATTGCGCTTAGCAAGTCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152710
TBATA MISSION shRNA shRNA Plasmid DNA
thymus, brain and testes associated
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152710.1-502s1c1
Sequence:CCGGCAGAAAGAACTGGTGATCCCACTCGAGTGGGATCACCAGTTCTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152710.1-870s1c1
Sequence:CCGGCAAGGAGGATGAACTGAAGAACTCGAGTTCTTCAGTTCATCCTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152710.1-1264s1c1
Sequence:CCGGGAAGTGCATGAACCTCCTCAACTCGAGTTGAGGAGGTTCATGCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161655    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152710.1-1360s1c1
Sequence:CCGGGAGTACATTGGAGAAGCTCAACTCGAGTTGAGCTTCTCCAATGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152710.1-1386s1c1
Sequence:CCGGCCAGATGCATTCAAGCCAGAACTCGAGTTCTGGCTTGAATGCATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152710.1-714s1c1
Sequence:CCGGCTTGCCTGAGTCAACTGTCTTCTCGAGAAGACAGTTGACTCAGGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135388    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152710.1-888s1c1
Sequence:CCGGGAAGAAAGAGAAGGAGCAGAACTCGAGTTCTGCTCCTTCTCTTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135817    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152710.1-1407s1c1
Sequence:CCGGCACAGAGAAGAAGACATCGAACTCGAGTTCGATGTCTTCTTCTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152710.2-649s21c1
Sequence:CCGGCACGTGACCCACATCCAAGATCTCGAGATCTTGGATGTGGGTCACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152710.2-604s21c1
Sequence:CCGGCTCAGTCACCACTCCTTCTTCCTCGAGGAAGAAGGAGTGGTGACTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152710.2-1111s21c1
Sequence:CCGGACAGACTTGCTAAGCGCAATCCTCGAGGATTGCGCTTAGCAAGTCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152710
TBATA MISSION shRNA Lentiviral Transduction Particles
thymus, brain and testes associated
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152710.1-502s1c1
Sequence:CCGGCAGAAAGAACTGGTGATCCCACTCGAGTGGGATCACCAGTTCTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152710.1-870s1c1
Sequence:CCGGCAAGGAGGATGAACTGAAGAACTCGAGTTCTTCAGTTCATCCTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152710.1-1264s1c1
Sequence:CCGGGAAGTGCATGAACCTCCTCAACTCGAGTTGAGGAGGTTCATGCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161655    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152710.1-1360s1c1
Sequence:CCGGGAGTACATTGGAGAAGCTCAACTCGAGTTGAGCTTCTCCAATGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152710.1-1386s1c1
Sequence:CCGGCCAGATGCATTCAAGCCAGAACTCGAGTTCTGGCTTGAATGCATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152710.1-714s1c1
Sequence:CCGGCTTGCCTGAGTCAACTGTCTTCTCGAGAAGACAGTTGACTCAGGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135388    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152710.1-888s1c1
Sequence:CCGGGAAGAAAGAGAAGGAGCAGAACTCGAGTTCTGCTCCTTCTCTTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135817    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152710.1-1407s1c1
Sequence:CCGGCACAGAGAAGAAGACATCGAACTCGAGTTCGATGTCTTCTTCTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152710.2-649s21c1
Sequence:CCGGCACGTGACCCACATCCAAGATCTCGAGATCTTGGATGTGGGTCACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152710.2-604s21c1
Sequence:CCGGCTCAGTCACCACTCCTTCTTCCTCGAGGAAGAAGGAGTGGTGACTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152710.2-1111s21c1
Sequence:CCGGACAGACTTGCTAAGCGCAATCCTCGAGGATTGCGCTTAGCAAGTCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023064
TBATA MISSION shRNA Bacterial Glycerol Stock
thymus, brain and testes associated
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000126709    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023064.3-871s1c1
Sequence:CCGGCCTAGCAGAGAAATCCAAGAACTCGAGTTCTTGGATTTCTCTGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023064.3-373s1c1
Sequence:CCGGGAGTGACTCATATCCAAGTTACTCGAGTAACTTGGATATGAGTCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023064.3-692s1c1
Sequence:CCGGGACTGTCTTCACTAAGGAAATCTCGAGATTTCCTTAGTGAAGACAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023064.3-310s1c1
Sequence:CCGGCCTACCGCTTTGGACGCCTAACTCGAGTTAGGCGTCCAAAGCGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023064.3-236s1c1
Sequence:CCGGCATTGTGGATTTCGAGCTGATCTCGAGATCAGCTCGAAATCCACAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023064
TBATA MISSION shRNA shRNA Plasmid DNA
thymus, brain and testes associated
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000126709    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023064.3-871s1c1
Sequence:CCGGCCTAGCAGAGAAATCCAAGAACTCGAGTTCTTGGATTTCTCTGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023064.3-373s1c1
Sequence:CCGGGAGTGACTCATATCCAAGTTACTCGAGTAACTTGGATATGAGTCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023064.3-692s1c1
Sequence:CCGGGACTGTCTTCACTAAGGAAATCTCGAGATTTCCTTAGTGAAGACAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023064.3-310s1c1
Sequence:CCGGCCTACCGCTTTGGACGCCTAACTCGAGTTAGGCGTCCAAAGCGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023064.3-236s1c1
Sequence:CCGGCATTGTGGATTTCGAGCTGATCTCGAGATCAGCTCGAAATCCACAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023064
TBATA MISSION shRNA Lentiviral Transduction Particles
thymus, brain and testes associated
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000126709    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023064.3-871s1c1
Sequence:CCGGCCTAGCAGAGAAATCCAAGAACTCGAGTTCTTGGATTTCTCTGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023064.3-373s1c1
Sequence:CCGGGAGTGACTCATATCCAAGTTACTCGAGTAACTTGGATATGAGTCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023064.3-692s1c1
Sequence:CCGGGACTGTCTTCACTAAGGAAATCTCGAGATTTCCTTAGTGAAGACAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023064.3-310s1c1
Sequence:CCGGCCTACCGCTTTGGACGCCTAACTCGAGTTAGGCGTCCAAAGCGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023064.3-236s1c1
Sequence:CCGGCATTGTGGATTTCGAGCTGATCTCGAGATCAGCTCGAAATCCACAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks