EMAIL THIS PAGE TO A FRIEND

TBC1D10A

TBC1 domain family, member 10A

Synonyms: EPI64 TBC1D10 dJ130H16.1 dJ130H16.2
UniProtKB ID: Q9BXI6, B3KXT8, O76053, Q543A2
Gene ID:
Mouse(103724) TBC1 domain family, member 10a
Rat(360968) TBC1 domain family, member 10a
naked mole-rat(101716701) TBC1 domain family, member 10A
domestic guinea pig(100713148) TBC1 domain family, member 10A
cow(511933) TBC1 domain family, member 10A
sheep(101122982) TBC1 domain family, member 10A
Zebrafish(562628) TBC1 domain family, member 10A
chicken(417011) TBC1 domain family, member 10A
domestic cat(101094631) TBC1 domain family, member 10A
Horse(100064004) TBC1 domain family, member 10A
dog(486350) TBC1 domain family, member 10A
87 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031937 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031937 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031937 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_134023 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134023 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134023 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031937 Rosetta Predictions human pricing
NM_001015022 Rosetta Predictions rat pricing
NM_134023 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031937 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00195443 predicted 1668
2 SASI_Hs02_00359077 predicted 1193
3 SASI_Hs01_00195444 predicted 552
4 SASI_Hs01_00195445 predicted 1528
5 SASI_Hs01_00195446 predicted 389
6 SASI_Hs01_00195447 predicted 1594
7 SASI_Hs01_00195448 predicted 497
8 SASI_Hs01_00195449 predicted 641
9 SASI_Hs01_00195450 predicted 1095
10 SASI_Hs01_00195451 predicted 819
11 SASI_Hs01_00195452 predicted 393
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001015022 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00202079 predicted 363
2 SASI_Rn02_00202080 predicted 438
3 SASI_Rn01_00051614 predicted 478
4 SASI_Rn01_00051616 predicted 863
5 SASI_Rn01_00051618 predicted 639
6 SASI_Rn01_00051619 predicted 709
7 SASI_Rn01_00051620 predicted 522
8 SASI_Rn01_00051621 predicted 377
9 SASI_Rn02_00202081 predicted 238
10 SASI_Rn02_00202082 predicted 618
11 SASI_Rn01_00051615 predicted 228
12 SASI_Rn01_00051617 predicted 1507
13 SASI_Rn01_00051622 predicted 1702
14 SASI_Rn01_00051623 predicted 1560
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134023 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00060627 predicted 872
2 SASI_Mm01_00060628 predicted 1678
3 SASI_Mm01_00060629 predicted 1482
4 SASI_Mm01_00060630 predicted 701
5 SASI_Mm01_00060631 predicted 776
6 SASI_Mm01_00060632 predicted 418
7 SASI_Mm01_00060633 predicted 1360
8 SASI_Mm01_00060634 predicted 527
9 SASI_Mm01_00060635 predicted 1537
10 SASI_Mm01_00060636 predicted 766
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031937
VALIDATED
TBC1D10A MISSION shRNA Bacterial Glycerol Stock
TBC1 domain family, member 10A
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166370    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031937.1-823s1c1
Sequence:CCGGCCGCTCCTCTATATGACAGAACTCGAGTTCTGTCATATAGAGGAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164964    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031937.1-1530s1c1
Sequence:CCGGGAGTGAGGACACCTACTTGTACTCGAGTACAAGTAGGTGTCCTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161276    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031937.1-1718s1c1
Sequence:CCGGGCCTGAGCCTCCTTATTTATTCTCGAGAATAAATAAGGAGGCTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_031937.1-405s1c1
Sequence:CCGGCAAGGTGAAGTTACAGCAGAACTCGAGTTCTGCTGTAACTTCACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160420    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_031937.1-1584s1c1
Sequence:CCGGCCATATAACTACACGGTTCATCTCGAGATGAACCGTGTAGTTATATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160768    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031937.1-824s1c1
Sequence:CCGGCGCTCCTCTATATGACAGAATCTCGAGATTCTGTCATATAGAGGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161018    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031937.1-507s1c1
Sequence:CCGGGTTCCCATTCCATGAGATGTTCTCGAGAACATCTCATGGAATGGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166039    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031937.1-678s1c1
Sequence:CCGGCCTGGTACAGATCTGTGAGAACTCGAGTTCTCACAGATCTGTACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432197    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031937.1-1675s21c1
Sequence:CCGGTGGCTGGTCCAACACAGATTCCTCGAGGAATCTGTGTTGGACCAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031937.1-1044s21c1
Sequence:CCGGGATCATGCAGGAGGCCTTTCTCTCGAGAGAAAGGCCTCCTGCATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031937.1-332s21c1
Sequence:CCGGAGATTCGTCTGCGGTGCCAAACTCGAGTTTGGCACCGCAGACGAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031937
VALIDATED
TBC1D10A MISSION shRNA shRNA Plasmid DNA
TBC1 domain family, member 10A
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166370    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031937.1-823s1c1
Sequence:CCGGCCGCTCCTCTATATGACAGAACTCGAGTTCTGTCATATAGAGGAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164964    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031937.1-1530s1c1
Sequence:CCGGGAGTGAGGACACCTACTTGTACTCGAGTACAAGTAGGTGTCCTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161276    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031937.1-1718s1c1
Sequence:CCGGGCCTGAGCCTCCTTATTTATTCTCGAGAATAAATAAGGAGGCTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_031937.1-405s1c1
Sequence:CCGGCAAGGTGAAGTTACAGCAGAACTCGAGTTCTGCTGTAACTTCACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160420    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_031937.1-1584s1c1
Sequence:CCGGCCATATAACTACACGGTTCATCTCGAGATGAACCGTGTAGTTATATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160768    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031937.1-824s1c1
Sequence:CCGGCGCTCCTCTATATGACAGAATCTCGAGATTCTGTCATATAGAGGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161018    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031937.1-507s1c1
Sequence:CCGGGTTCCCATTCCATGAGATGTTCTCGAGAACATCTCATGGAATGGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166039    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031937.1-678s1c1
Sequence:CCGGCCTGGTACAGATCTGTGAGAACTCGAGTTCTCACAGATCTGTACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432197    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031937.1-1675s21c1
Sequence:CCGGTGGCTGGTCCAACACAGATTCCTCGAGGAATCTGTGTTGGACCAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031937.1-1044s21c1
Sequence:CCGGGATCATGCAGGAGGCCTTTCTCTCGAGAGAAAGGCCTCCTGCATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031937.1-332s21c1
Sequence:CCGGAGATTCGTCTGCGGTGCCAAACTCGAGTTTGGCACCGCAGACGAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031937
VALIDATED
TBC1D10A MISSION shRNA Lentiviral Transduction Particles
TBC1 domain family, member 10A
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166370    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031937.1-823s1c1
Sequence:CCGGCCGCTCCTCTATATGACAGAACTCGAGTTCTGTCATATAGAGGAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164964    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031937.1-1530s1c1
Sequence:CCGGGAGTGAGGACACCTACTTGTACTCGAGTACAAGTAGGTGTCCTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161276    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031937.1-1718s1c1
Sequence:CCGGGCCTGAGCCTCCTTATTTATTCTCGAGAATAAATAAGGAGGCTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_031937.1-405s1c1
Sequence:CCGGCAAGGTGAAGTTACAGCAGAACTCGAGTTCTGCTGTAACTTCACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160420    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_031937.1-1584s1c1
Sequence:CCGGCCATATAACTACACGGTTCATCTCGAGATGAACCGTGTAGTTATATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160768    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031937.1-824s1c1
Sequence:CCGGCGCTCCTCTATATGACAGAATCTCGAGATTCTGTCATATAGAGGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161018    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031937.1-507s1c1
Sequence:CCGGGTTCCCATTCCATGAGATGTTCTCGAGAACATCTCATGGAATGGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166039    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031937.1-678s1c1
Sequence:CCGGCCTGGTACAGATCTGTGAGAACTCGAGTTCTCACAGATCTGTACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432197    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031937.1-1675s21c1
Sequence:CCGGTGGCTGGTCCAACACAGATTCCTCGAGGAATCTGTGTTGGACCAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031937.1-1044s21c1
Sequence:CCGGGATCATGCAGGAGGCCTTTCTCTCGAGAGAAAGGCCTCCTGCATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031937.1-332s21c1
Sequence:CCGGAGATTCGTCTGCGGTGCCAAACTCGAGTTTGGCACCGCAGACGAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134023
VALIDATED
TBC1D10A MISSION shRNA Bacterial Glycerol Stock
TBC1 domain family, member 10A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106060    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134023.1-1593s1c1
Sequence:CCGGCTCACGTCTTACACGGTTCAACTCGAGTTGAACCGTGTAAGACGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134023.1-1540s1c1
Sequence:CCGGGAGTGAGGACACCTACTTGTACTCGAGTACAAGTAGGTGTCCTCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134023.1-367s1c1
Sequence:CCGGGATTCGTCTTCGATGCCAGAACTCGAGTTCTGGCATCGAAGACGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134023.1-220s1c1
Sequence:CCGGCATCGACAAGTTCGGATTCATCTCGAGATGAATCCGAACTTGTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134023.1-740s1c1
Sequence:CCGGCCTGGCTACTACAGTGAGAAACTCGAGTTTCTCACTGTAGTAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134023
VALIDATED
TBC1D10A MISSION shRNA shRNA Plasmid DNA
TBC1 domain family, member 10A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106060    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134023.1-1593s1c1
Sequence:CCGGCTCACGTCTTACACGGTTCAACTCGAGTTGAACCGTGTAAGACGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134023.1-1540s1c1
Sequence:CCGGGAGTGAGGACACCTACTTGTACTCGAGTACAAGTAGGTGTCCTCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134023.1-367s1c1
Sequence:CCGGGATTCGTCTTCGATGCCAGAACTCGAGTTCTGGCATCGAAGACGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134023.1-220s1c1
Sequence:CCGGCATCGACAAGTTCGGATTCATCTCGAGATGAATCCGAACTTGTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134023.1-740s1c1
Sequence:CCGGCCTGGCTACTACAGTGAGAAACTCGAGTTTCTCACTGTAGTAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134023
VALIDATED
TBC1D10A MISSION shRNA Lentiviral Transduction Particles
TBC1 domain family, member 10A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106060    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134023.1-1593s1c1
Sequence:CCGGCTCACGTCTTACACGGTTCAACTCGAGTTGAACCGTGTAAGACGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134023.1-1540s1c1
Sequence:CCGGGAGTGAGGACACCTACTTGTACTCGAGTACAAGTAGGTGTCCTCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134023.1-367s1c1
Sequence:CCGGGATTCGTCTTCGATGCCAGAACTCGAGTTCTGGCATCGAAGACGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134023.1-220s1c1
Sequence:CCGGCATCGACAAGTTCGGATTCATCTCGAGATGAATCCGAACTTGTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134023.1-740s1c1
Sequence:CCGGCCTGGCTACTACAGTGAGAAACTCGAGTTTCTCACTGTAGTAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks