EMAIL THIS PAGE TO A FRIEND

TBC1D10B

TBC1 domain family, member 10B

Synonyms: EPI64B
Gene ID:
Human(26000) Summary: Small G proteins of the RAB family (see MIM 179508) function in intracellular vesicle trafficking by switching from the GTP-bound state to the GDP-bound state with the assistance of guanine nucleotide exchange factors (GEFs; see MIM 609700) and GTPase-activating proteins (GAPs). TBC1D10B functions as a GAP for several proteins of the Rab family (Ishibashi et al., 2009 [PubMed 19077034]
Mouse(68449) TBC1 domain family, member 10b
Rat(365372) TBC1 domain family, member 10b
Zebrafish(556457) TBC1 domain family, member 10b
Horse(100063852) TBC1 domain family, member 10B
domestic cat(101086439) TBC1 domain family, member 10B
dog(489935) TBC1 domain family, member 10B
cow(513858) TBC1 domain family, member 10B
sheep(101120980) TBC1 domain family, member 10B
domestic guinea pig(100728471) TBC1 domain family, member 10B
naked mole-rat(101721289) TBC1 domain family, member 10B
91 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144522 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144522 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144522 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015527 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015527 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015527 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU089471 MISSION® esiRNA esiRNA targeting mouse Tbc1d10b (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015527 Rosetta Predictions human pricing
NM_144522 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015527 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00205108 predicted 2755
2 SASI_Hs01_00205109 predicted 954
3 SASI_Hs01_00205110 predicted 2700
4 SASI_Hs01_00205111 predicted 1282
5 SASI_Hs01_00205113 predicted 2875
6 SASI_Hs02_00348028 predicted 563
7 SASI_Hs01_00205114 predicted 1741
8 SASI_Hs01_00205115 predicted 1289
9 SASI_Hs01_00205116 predicted 877
10 SASI_Hs01_00205117 predicted 1546
11 SASI_Hs01_00205112 predicted 540
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144522 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00044983 predicted 1770
2 SASI_Mm01_00044984 predicted 1513
3 SASI_Mm01_00044985 predicted 1597
4 SASI_Mm02_00340041 predicted 640
5 SASI_Mm01_00044986 predicted 1514
6 SASI_Mm01_00044987 predicted 1774
7 SASI_Mm01_00044988 predicted 1114
8 SASI_Mm01_00044989 predicted 1071
9 SASI_Mm01_00044990 predicted 1892
10 SASI_Mm01_00044991 predicted 1016
11 SASI_Mm01_00044992 predicted 921
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144522
VALIDATED
TBC1D10B MISSION shRNA Bacterial Glycerol Stock
TBC1 domain family, member 10B
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000324199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144522.5-1173s21c1
Sequence:CCGGGCAGTACCTGTCTAATAGCAACTCGAGTTGCTATTAGACAGGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144522.5-1773s21c1
Sequence:CCGGGCGCTCATGTCAAGGCATGTACTCGAGTACATGCCTTGACATGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144522.5-1627s21c1
Sequence:CCGGGAGTGGTTCATGTGCATCTTTCTCGAGAAAGATGCACATGAACCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305640    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144522.5-2898s21c1
Sequence:CCGGGGATATCCTTGTGTTGTAATTCTCGAGAATTACAACACAAGGATATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144522.5-932s21c1
Sequence:CCGGTGGGTTCAGACTCGGAGATAACTCGAGTTATCTCCGAGTCTGAACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106255    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144522.2-3328s1c1
Sequence:CCGGGCAGGCACAAAGTCTGACTTTCTCGAGAAAGTCAGACTTTGTGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144522.2-1774s1c1
Sequence:CCGGGCGCTCATGTCAAGGCATGTACTCGAGTACATGCCTTGACATGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144522.2-1628s1c1
Sequence:CCGGGAGTGGTTCATGTGCATCTTTCTCGAGAAAGATGCACATGAACCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144522.2-1174s1c1
Sequence:CCGGGCAGTACCTGTCTAATAGCAACTCGAGTTGCTATTAGACAGGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144522
VALIDATED
TBC1D10B MISSION shRNA shRNA Plasmid DNA
TBC1 domain family, member 10B
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000324199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144522.5-1173s21c1
Sequence:CCGGGCAGTACCTGTCTAATAGCAACTCGAGTTGCTATTAGACAGGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144522.5-1773s21c1
Sequence:CCGGGCGCTCATGTCAAGGCATGTACTCGAGTACATGCCTTGACATGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144522.5-1627s21c1
Sequence:CCGGGAGTGGTTCATGTGCATCTTTCTCGAGAAAGATGCACATGAACCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305640    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144522.5-2898s21c1
Sequence:CCGGGGATATCCTTGTGTTGTAATTCTCGAGAATTACAACACAAGGATATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144522.5-932s21c1
Sequence:CCGGTGGGTTCAGACTCGGAGATAACTCGAGTTATCTCCGAGTCTGAACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106255    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144522.2-3328s1c1
Sequence:CCGGGCAGGCACAAAGTCTGACTTTCTCGAGAAAGTCAGACTTTGTGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144522.2-1774s1c1
Sequence:CCGGGCGCTCATGTCAAGGCATGTACTCGAGTACATGCCTTGACATGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144522.2-1628s1c1
Sequence:CCGGGAGTGGTTCATGTGCATCTTTCTCGAGAAAGATGCACATGAACCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144522.2-1174s1c1
Sequence:CCGGGCAGTACCTGTCTAATAGCAACTCGAGTTGCTATTAGACAGGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144522
VALIDATED
TBC1D10B MISSION shRNA Lentiviral Transduction Particles
TBC1 domain family, member 10B
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000324199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144522.5-1173s21c1
Sequence:CCGGGCAGTACCTGTCTAATAGCAACTCGAGTTGCTATTAGACAGGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144522.5-1773s21c1
Sequence:CCGGGCGCTCATGTCAAGGCATGTACTCGAGTACATGCCTTGACATGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144522.5-1627s21c1
Sequence:CCGGGAGTGGTTCATGTGCATCTTTCTCGAGAAAGATGCACATGAACCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305640    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144522.5-2898s21c1
Sequence:CCGGGGATATCCTTGTGTTGTAATTCTCGAGAATTACAACACAAGGATATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144522.5-932s21c1
Sequence:CCGGTGGGTTCAGACTCGGAGATAACTCGAGTTATCTCCGAGTCTGAACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106255    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144522.2-3328s1c1
Sequence:CCGGGCAGGCACAAAGTCTGACTTTCTCGAGAAAGTCAGACTTTGTGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144522.2-1774s1c1
Sequence:CCGGGCGCTCATGTCAAGGCATGTACTCGAGTACATGCCTTGACATGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144522.2-1628s1c1
Sequence:CCGGGAGTGGTTCATGTGCATCTTTCTCGAGAAAGATGCACATGAACCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144522.2-1174s1c1
Sequence:CCGGGCAGTACCTGTCTAATAGCAACTCGAGTTGCTATTAGACAGGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015527
VALIDATED
TBC1D10B MISSION shRNA Bacterial Glycerol Stock
TBC1 domain family, member 10B
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000318981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015527.3-1128s21c1
Sequence:CCGGGCAGTACCTGTCTAATAGCAACTCGAGTTGCTATTAGACAGGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_015527.3-885s21c1
Sequence:CCGGCATGGGCTCAGATTCAGAGATCTCGAGATCTCTGAATCTGAGCCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015527.3-1014s21c1
Sequence:CCGGGCTCAAATGGCTGGACATGTTCTCGAGAACATGTCCAGCCATTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015527.3-1437s21c1
Sequence:CCGGCAAGTACCTCCCAGGTTACTACTCGAGTAGTAACCTGGGAGGTACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015527.2-816s1c1
Sequence:CCGGCAAGTACCTCCCAGGTTACTACTCGAGTAGTAACCTGGGAGGTACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015527.2-507s1c1
Sequence:CCGGGCAGTACCTGTCTAATAGCAACTCGAGTTGCTATTAGACAGGTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015527.2-393s1c1
Sequence:CCGGGCTCAAATGGCTGGACATGTTCTCGAGAACATGTCCAGCCATTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015527.2-264s1c1
Sequence:CCGGCATGGGCTCAGATTCAGAGATCTCGAGATCTCTGAATCTGAGCCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015527
VALIDATED
TBC1D10B MISSION shRNA shRNA Plasmid DNA
TBC1 domain family, member 10B
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000318981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015527.3-1128s21c1
Sequence:CCGGGCAGTACCTGTCTAATAGCAACTCGAGTTGCTATTAGACAGGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_015527.3-885s21c1
Sequence:CCGGCATGGGCTCAGATTCAGAGATCTCGAGATCTCTGAATCTGAGCCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015527.3-1014s21c1
Sequence:CCGGGCTCAAATGGCTGGACATGTTCTCGAGAACATGTCCAGCCATTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015527.3-1437s21c1
Sequence:CCGGCAAGTACCTCCCAGGTTACTACTCGAGTAGTAACCTGGGAGGTACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015527.2-816s1c1
Sequence:CCGGCAAGTACCTCCCAGGTTACTACTCGAGTAGTAACCTGGGAGGTACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015527.2-507s1c1
Sequence:CCGGGCAGTACCTGTCTAATAGCAACTCGAGTTGCTATTAGACAGGTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015527.2-393s1c1
Sequence:CCGGGCTCAAATGGCTGGACATGTTCTCGAGAACATGTCCAGCCATTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015527.2-264s1c1
Sequence:CCGGCATGGGCTCAGATTCAGAGATCTCGAGATCTCTGAATCTGAGCCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015527
VALIDATED
TBC1D10B MISSION shRNA Lentiviral Transduction Particles
TBC1 domain family, member 10B
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000318981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015527.3-1128s21c1
Sequence:CCGGGCAGTACCTGTCTAATAGCAACTCGAGTTGCTATTAGACAGGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_015527.3-885s21c1
Sequence:CCGGCATGGGCTCAGATTCAGAGATCTCGAGATCTCTGAATCTGAGCCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015527.3-1014s21c1
Sequence:CCGGGCTCAAATGGCTGGACATGTTCTCGAGAACATGTCCAGCCATTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015527.3-1437s21c1
Sequence:CCGGCAAGTACCTCCCAGGTTACTACTCGAGTAGTAACCTGGGAGGTACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015527.2-816s1c1
Sequence:CCGGCAAGTACCTCCCAGGTTACTACTCGAGTAGTAACCTGGGAGGTACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015527.2-507s1c1
Sequence:CCGGGCAGTACCTGTCTAATAGCAACTCGAGTTGCTATTAGACAGGTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015527.2-393s1c1
Sequence:CCGGGCTCAAATGGCTGGACATGTTCTCGAGAACATGTCCAGCCATTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015527.2-264s1c1
Sequence:CCGGCATGGGCTCAGATTCAGAGATCTCGAGATCTCTGAATCTGAGCCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks