EMAIL THIS PAGE TO A FRIEND

TBC1D10C

TBC1 domain family, member 10C

Synonyms: CARABIN EPI64C
UniProtKB ID: Q8IV04, G3V1D6
Gene ID:
Human(374403) Summary: The protein encoded by this gene has an N-terminal Rab-GTPase domain and a binding site at the C-terminus for calcineurin, and is an inhibitor of both the Ras signaling pathway and calcineurin, a phosphatase regulated by calcium and calmodulin. Genes encoding similar proteins are located on chromosomes 16 and 22. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2013]
Mouse(108995) TBC1 domain family, member 10c
Rat(361697) TBC1 domain family, member 10C
naked mole-rat(101704222) TBC1 domain family, member 10C
domestic guinea pig(100722153) TBC1 domain family, member 10C
cow(520599) TBC1 domain family, member 10C
sheep(101109052) TBC1 domain family, member 10C
dog(610509) TBC1 domain family, member 10C
domestic cat(101091561) TBC1 domain family, member 10C
Horse(100146355) TBC1 domain family, member 10C
85 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178650 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178650 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178650 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_198517 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198517 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198517 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU047331 MISSION® esiRNA esiRNA human TBC1D10C (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198517 Rosetta Predictions human pricing
NM_001081980 Rosetta Predictions rat pricing
NM_178650 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198517 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00080425 predicted 857
2 SASI_Hs01_00080427 predicted 250
3 SASI_Hs01_00080428 predicted 213
4 SASI_Hs01_00080429 predicted 278
5 SASI_Hs01_00080430 predicted 269
6 SASI_Hs01_00080431 predicted 454
7 SASI_Hs01_00080432 predicted 412
8 SASI_Hs01_00080433 predicted 781
9 SASI_Hs01_00080434 predicted 443
10 SASI_Hs02_00372097 predicted 629
11 SASI_Hs01_00080426 predicted 353
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081980 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00208689 predicted 694
2 SASI_Rn02_00208690 predicted 732
3 SASI_Rn02_00208691 predicted 1367
4 SASI_Rn02_00208692 predicted 1457
5 SASI_Rn02_00208693 predicted 277
6 SASI_Rn02_00208694 predicted 1405
7 SASI_Rn02_00208695 predicted 457
8 SASI_Rn02_00208696 predicted 1436
9 SASI_Rn02_00208697 predicted 1193
10 SASI_Rn02_00208698 predicted 1379
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178650 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00349073 predicted 1405
2 SASI_Mm02_00349074 predicted 1443
3 SASI_Mm02_00349075 predicted 1529
4 SASI_Mm02_00349076 predicted 1282
5 SASI_Mm02_00349077 predicted 1377
6 SASI_Mm01_00133542 predicted 283
7 SASI_Mm02_00349078 predicted 1452
8 SASI_Mm02_00349079 predicted 1192
9 SASI_Mm01_00133547 predicted 296
10 SASI_Mm02_00349080 predicted 1205
11 SASI_Mm01_00133541 predicted 718
12 SASI_Mm01_00133543 predicted 340
13 SASI_Mm01_00133544 predicted 352
14 SASI_Mm01_00133545 predicted 525
15 SASI_Mm01_00133546 predicted 550
16 SASI_Mm01_00133548 predicted 748
17 SASI_Mm01_00133549 predicted 1005
18 SASI_Mm01_00133550 predicted 934
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178650
TBC1D10C MISSION shRNA Bacterial Glycerol Stock
TBC1 domain family, member 10C
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106200    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178650.2-1441s1c1
Sequence:CCGGCCCAGGCATGTATCCTCTATTCTCGAGAATAGAGGATACATGCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178650.2-351s1c1
Sequence:CCGGCCGACGATACAAGAAGGTAAACTCGAGTTTACCTTCTTGTATCGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178650.2-223s1c1
Sequence:CCGGGCTGACCGTTATGGCTTCATTCTCGAGAATGAAGCCATAACGGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178650.2-523s1c1
Sequence:CCGGAGAGACTTGCACCGTCAGTTTCTCGAGAAACTGACGGTGCAAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178650.2-354s1c1
Sequence:CCGGACGATACAAGAAGGTAAAGATCTCGAGATCTTTACCTTCTTGTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178650
TBC1D10C MISSION shRNA shRNA Plasmid DNA
TBC1 domain family, member 10C
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106200    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178650.2-1441s1c1
Sequence:CCGGCCCAGGCATGTATCCTCTATTCTCGAGAATAGAGGATACATGCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178650.2-351s1c1
Sequence:CCGGCCGACGATACAAGAAGGTAAACTCGAGTTTACCTTCTTGTATCGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178650.2-223s1c1
Sequence:CCGGGCTGACCGTTATGGCTTCATTCTCGAGAATGAAGCCATAACGGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178650.2-523s1c1
Sequence:CCGGAGAGACTTGCACCGTCAGTTTCTCGAGAAACTGACGGTGCAAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178650.2-354s1c1
Sequence:CCGGACGATACAAGAAGGTAAAGATCTCGAGATCTTTACCTTCTTGTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178650
TBC1D10C MISSION shRNA Lentiviral Transduction Particles
TBC1 domain family, member 10C
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106200    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178650.2-1441s1c1
Sequence:CCGGCCCAGGCATGTATCCTCTATTCTCGAGAATAGAGGATACATGCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178650.2-351s1c1
Sequence:CCGGCCGACGATACAAGAAGGTAAACTCGAGTTTACCTTCTTGTATCGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178650.2-223s1c1
Sequence:CCGGGCTGACCGTTATGGCTTCATTCTCGAGAATGAAGCCATAACGGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178650.2-523s1c1
Sequence:CCGGAGAGACTTGCACCGTCAGTTTCTCGAGAAACTGACGGTGCAAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178650.2-354s1c1
Sequence:CCGGACGATACAAGAAGGTAAAGATCTCGAGATCTTTACCTTCTTGTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198517
TBC1D10C MISSION shRNA Bacterial Glycerol Stock
TBC1 domain family, member 10C
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198517.2-139s21c1
Sequence:CCGGCCGACCGCTATGGATTCATTGCTCGAGCAATGAATCCATAGCGGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198517.2-520s21c1
Sequence:CCGGTCAAGGCCTACACCCTGTATCCTCGAGGATACAGGGTGTAGGCCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198517.2-1367s21c1
Sequence:CCGGCTGAGAGGACCATGGACTTAGCTCGAGCTAAGTCCATGGTCCTCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198517.2-267s21c1
Sequence:CCGGCGGCGGTACAAGAAGGTAAAGCTCGAGCTTTACCTTCTTGTACCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242973    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198517.2-1428s21c1
Sequence:CCGGGGCAAATAGGCACCGCACTTTCTCGAGAAAGTGCGGTGCCTATTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198517
TBC1D10C MISSION shRNA shRNA Plasmid DNA
TBC1 domain family, member 10C
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198517.2-139s21c1
Sequence:CCGGCCGACCGCTATGGATTCATTGCTCGAGCAATGAATCCATAGCGGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198517.2-520s21c1
Sequence:CCGGTCAAGGCCTACACCCTGTATCCTCGAGGATACAGGGTGTAGGCCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198517.2-1367s21c1
Sequence:CCGGCTGAGAGGACCATGGACTTAGCTCGAGCTAAGTCCATGGTCCTCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198517.2-267s21c1
Sequence:CCGGCGGCGGTACAAGAAGGTAAAGCTCGAGCTTTACCTTCTTGTACCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242973    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198517.2-1428s21c1
Sequence:CCGGGGCAAATAGGCACCGCACTTTCTCGAGAAAGTGCGGTGCCTATTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198517
TBC1D10C MISSION shRNA Lentiviral Transduction Particles
TBC1 domain family, member 10C
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198517.2-139s21c1
Sequence:CCGGCCGACCGCTATGGATTCATTGCTCGAGCAATGAATCCATAGCGGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198517.2-520s21c1
Sequence:CCGGTCAAGGCCTACACCCTGTATCCTCGAGGATACAGGGTGTAGGCCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198517.2-1367s21c1
Sequence:CCGGCTGAGAGGACCATGGACTTAGCTCGAGCTAAGTCCATGGTCCTCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198517.2-267s21c1
Sequence:CCGGCGGCGGTACAAGAAGGTAAAGCTCGAGCTTTACCTTCTTGTACCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242973    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198517.2-1428s21c1
Sequence:CCGGGGCAAATAGGCACCGCACTTTCTCGAGAAAGTGCGGTGCCTATTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks