EMAIL THIS PAGE TO A FRIEND

TBC1D12

TBC1 domain family, member 12

UniProtKB ID: O60347, Q5VYA6, Q8WX26, Q8WX59, Q9UG83
Gene ID:
Mouse(209478) TBC1D12: TBC1 domain family, member 12
chicken(768541) TBC1 domain family, member 12
dog(612776) TBC1 domain family, member 12
Horse(100071103) TBC1 domain family, member 12
domestic cat(101095133) TBC1 domain family, member 12
cow(509093) TBC1 domain family, member 12
sheep(101106221) TBC1 domain family, member 12
domestic guinea pig(100727626) TBC1 domain family, member 12
naked mole-rat(101707054) TBC1 domain family, member 12
126 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015188 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015188 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015188 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145952 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145952 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145952 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015188 Rosetta Predictions human pricing
XM_051081 Rosetta Predictions human pricing
NM_145952 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015188 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00347237 predicted 2360
2 SASI_Hs02_00347238 predicted 2276
3 SASI_Hs02_00347239 predicted 1853
4 SASI_Hs02_00347240 predicted 1552
5 SASI_Hs02_00347241 predicted 2345
6 SASI_Hs02_00347242 predicted 1831
7 SASI_Hs02_00347243 predicted 1425
8 SASI_Hs02_00347244 predicted 2388
9 SASI_Hs02_00347245 predicted 1881
10 SASI_Hs02_00347246 predicted 1770
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_051081 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00284176 predicted 2462
2 SASI_Hs01_00284177 predicted 2381
3 SASI_Hs01_00284178 predicted 1950
4 SASI_Hs01_00284179 predicted 1648
5 SASI_Hs01_00284180 predicted 2438
6 SASI_Hs01_00284181 predicted 1930
7 SASI_Hs01_00284182 predicted 1524
8 SASI_Hs01_00284183 predicted 2492
9 SASI_Hs01_00284184 predicted 1986
10 SASI_Hs01_00284185 predicted 1868
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145952 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00137204 predicted 1295
2 SASI_Mm01_00137205 predicted 1853
3 SASI_Mm01_00137206 predicted 1911
4 SASI_Mm01_00137207 predicted 1267
5 SASI_Mm01_00137208 predicted 1542
6 SASI_Mm01_00137209 predicted 2136
7 SASI_Mm01_00137210 predicted 1886
8 SASI_Mm02_00341419 predicted 1549
9 SASI_Mm01_00137211 predicted 2042
10 SASI_Mm01_00137212 predicted 1105
11 SASI_Mm01_00137213 predicted 2059
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015188
VALIDATED
TBC1D12 MISSION shRNA Bacterial Glycerol Stock
TBC1 domain family, member 12
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015188.1-2284s21c1
Sequence:CCGGGATTAGGAATCCTCCGATTATCTCGAGATAATCGGAGGATTCCTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015188.1-2152s21c1
Sequence:CCGGACAGTCTTACACCAGATATATCTCGAGATATATCTGGTGTAAGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265414    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015188.1-4716s21c1
Sequence:CCGGGTTATGAGTGATGGCTATATACTCGAGTATATAGCCATCACTCATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015188.1-2182s21c1
Sequence:CCGGACTGGATCTTCACACTATATACTCGAGTATATAGTGTGAAGATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015188.1-1507s21c1
Sequence:CCGGGAATCATGAAAGAACGATTTACTCGAGTAAATCGTTCTTTCATGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015188
VALIDATED
TBC1D12 MISSION shRNA shRNA Plasmid DNA
TBC1 domain family, member 12
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015188.1-2284s21c1
Sequence:CCGGGATTAGGAATCCTCCGATTATCTCGAGATAATCGGAGGATTCCTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015188.1-2152s21c1
Sequence:CCGGACAGTCTTACACCAGATATATCTCGAGATATATCTGGTGTAAGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265414    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015188.1-4716s21c1
Sequence:CCGGGTTATGAGTGATGGCTATATACTCGAGTATATAGCCATCACTCATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015188.1-2182s21c1
Sequence:CCGGACTGGATCTTCACACTATATACTCGAGTATATAGTGTGAAGATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015188.1-1507s21c1
Sequence:CCGGGAATCATGAAAGAACGATTTACTCGAGTAAATCGTTCTTTCATGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015188
VALIDATED
TBC1D12 MISSION shRNA Lentiviral Transduction Particles
TBC1 domain family, member 12
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015188.1-2284s21c1
Sequence:CCGGGATTAGGAATCCTCCGATTATCTCGAGATAATCGGAGGATTCCTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015188.1-2152s21c1
Sequence:CCGGACAGTCTTACACCAGATATATCTCGAGATATATCTGGTGTAAGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265414    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015188.1-4716s21c1
Sequence:CCGGGTTATGAGTGATGGCTATATACTCGAGTATATAGCCATCACTCATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015188.1-2182s21c1
Sequence:CCGGACTGGATCTTCACACTATATACTCGAGTATATAGTGTGAAGATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015188.1-1507s21c1
Sequence:CCGGGAATCATGAAAGAACGATTTACTCGAGTAAATCGTTCTTTCATGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145952
TBC1D12 MISSION shRNA Bacterial Glycerol Stock
TBC1 domain family, member 12
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000216124    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145952.3-1264s1c1
Sequence:CCGGCAATGGTAATTTGGATCAATGCTCGAGCATTGATCCAAATTACCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215892    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145952.3-1848s1c1
Sequence:CCGGCTTCATTTCAAGTCGTATAATCTCGAGATTATACGACTTGAAATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145952.1-428s1c1
Sequence:CCGGGATGCAGAATAGCACCAAGAACTCGAGTTCTTGGTGCTATTCTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145952.1-377s1c1
Sequence:CCGGGCCAGAAGATATAACATCAGACTCGAGTCTGATGTTATATCTTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173220    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145952.1-440s1c1
Sequence:CCGGCACCAAGAAATGGACTCAGGTCTCGAGACCTGAGTCCATTTCTTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145952.1-465s1c1
Sequence:CCGGGCATCTGTAGCAAAGGACATTCTCGAGAATGTCCTTTGCTACAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145952.1-333s1c1
Sequence:CCGGCTACAGATGGACTTTATTCATCTCGAGATGAATAAAGTCCATCTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145952.1-330s1c1
Sequence:CCGGCTCCTACAGATGGACTTTATTCTCGAGAATAAAGTCCATCTGTAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145952
TBC1D12 MISSION shRNA shRNA Plasmid DNA
TBC1 domain family, member 12
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000216124    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145952.3-1264s1c1
Sequence:CCGGCAATGGTAATTTGGATCAATGCTCGAGCATTGATCCAAATTACCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215892    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145952.3-1848s1c1
Sequence:CCGGCTTCATTTCAAGTCGTATAATCTCGAGATTATACGACTTGAAATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145952.1-428s1c1
Sequence:CCGGGATGCAGAATAGCACCAAGAACTCGAGTTCTTGGTGCTATTCTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145952.1-377s1c1
Sequence:CCGGGCCAGAAGATATAACATCAGACTCGAGTCTGATGTTATATCTTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173220    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145952.1-440s1c1
Sequence:CCGGCACCAAGAAATGGACTCAGGTCTCGAGACCTGAGTCCATTTCTTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145952.1-465s1c1
Sequence:CCGGGCATCTGTAGCAAAGGACATTCTCGAGAATGTCCTTTGCTACAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145952.1-333s1c1
Sequence:CCGGCTACAGATGGACTTTATTCATCTCGAGATGAATAAAGTCCATCTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145952.1-330s1c1
Sequence:CCGGCTCCTACAGATGGACTTTATTCTCGAGAATAAAGTCCATCTGTAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145952
TBC1D12 MISSION shRNA Lentiviral Transduction Particles
TBC1 domain family, member 12
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000216124    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145952.3-1264s1c1
Sequence:CCGGCAATGGTAATTTGGATCAATGCTCGAGCATTGATCCAAATTACCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215892    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145952.3-1848s1c1
Sequence:CCGGCTTCATTTCAAGTCGTATAATCTCGAGATTATACGACTTGAAATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145952.1-428s1c1
Sequence:CCGGGATGCAGAATAGCACCAAGAACTCGAGTTCTTGGTGCTATTCTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145952.1-377s1c1
Sequence:CCGGGCCAGAAGATATAACATCAGACTCGAGTCTGATGTTATATCTTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173220    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145952.1-440s1c1
Sequence:CCGGCACCAAGAAATGGACTCAGGTCTCGAGACCTGAGTCCATTTCTTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145952.1-465s1c1
Sequence:CCGGGCATCTGTAGCAAAGGACATTCTCGAGAATGTCCTTTGCTACAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145952.1-333s1c1
Sequence:CCGGCTACAGATGGACTTTATTCATCTCGAGATGAATAAAGTCCATCTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145952.1-330s1c1
Sequence:CCGGCTCCTACAGATGGACTTTATTCTCGAGAATAAAGTCCATCTGTAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks