EMAIL THIS PAGE TO A FRIEND

TBC1D13

TBC1 domain family, member 13

UniProtKB ID: Q9NVG8, Q5T270, Q5T271
Gene ID:
Mouse(70296) TBC1 domain family, member 13
Rat(499768) TBC1 domain family, member 13
Zebrafish(561380) TBC1 domain family, member 13
chicken(771771) TBC1 domain family, member 13
dog(480702) TBC1 domain family, member 13
domestic cat(101082353) TBC1 domain family, member 13
Horse(100070184) TBC1 domain family, member 13
naked mole-rat(101717536) TBC1 domain family, member 13
domestic guinea pig(100728808) TBC1 domain family, member 13
cow(509584) TBC1 domain family, member 13
sheep(101118173) TBC1 domain family, member 13
101 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_146252 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146252 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146252 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018201 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018201 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018201 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018201 Rosetta Predictions human pricing
XM_001077153 Rosetta Predictions rat pricing
XM_575106 Rosetta Predictions rat pricing
NM_146252 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018201 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00012994 predicted 401
2 SASI_Hs02_00351487 predicted 233
3 SASI_Hs01_00012995 predicted 410
4 SASI_Hs01_00012997 predicted 815
5 SASI_Hs02_00351488 predicted 868
6 SASI_Hs01_00012999 predicted 497
7 SASI_Hs01_00013000 predicted 867
8 SASI_Hs01_00013001 predicted 1185
9 SASI_Hs01_00013002 predicted 1194
10 SASI_Hs01_00013003 predicted 502
11 SASI_Hs01_00012996 predicted 890
12 SASI_Hs01_00012998 predicted 1369
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077153 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00355960 predicted 199
2 SASI_Rn02_00355961 predicted 835
3 SASI_Rn02_00355962 predicted 615
4 SASI_Rn02_00355963 predicted 434
5 SASI_Rn02_00355964 predicted 390
6 SASI_Rn02_00355965 predicted 1106
7 SASI_Rn02_00355966 predicted 1041
8 SASI_Rn02_00355967 predicted 251
9 SASI_Rn02_00355968 predicted 1186
10 SASI_Rn02_00355969 predicted 967
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575106 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00403065 predicted 202
2 SASI_Rn02_00403066 predicted 435
3 SASI_Rn02_00403067 predicted 437
4 SASI_Rn02_00403068 predicted 392
5 SASI_Rn02_00403069 predicted 254
6 SASI_Rn02_00403070 predicted 310
7 SASI_Rn02_00403071 predicted 246
8 SASI_Rn02_00403072 predicted 390
9 SASI_Rn02_00403073 predicted 389
10 SASI_Rn02_00403074 predicted 486
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146252 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00167881 predicted 756
2 SASI_Mm01_00167882 predicted 897
3 SASI_Mm01_00167883 predicted 375
4 SASI_Mm01_00167884 predicted 395
5 SASI_Mm01_00167885 predicted 1078
6 SASI_Mm01_00167886 predicted 1210
7 SASI_Mm02_00341984 predicted 811
8 SASI_Mm01_00167887 predicted 516
9 SASI_Mm01_00167888 predicted 843
10 SASI_Mm01_00167890 predicted 1048
11 SASI_Mm01_00167889 predicted 204
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146252
VALIDATED
TBC1D13 MISSION shRNA Bacterial Glycerol Stock
TBC1 domain family, member 13
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183468    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_146252.1-2549s1c1
Sequence:CCGGGCTTGATCTATCTTCTGACTTCTCGAGAAGTCAGAAGATAGATCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179787    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146252.1-972s1c1
Sequence:CCGGGAGTATCAAGCCTCAGTTCTTCTCGAGAAGAACTGAGGCTTGATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216876    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146252.2-235s1c1
Sequence:CCGGGTTCCTGAGAGAGATGATTATCTCGAGATAATCATCTCTCTCAGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_146252.2-1048s21c1
Sequence:CCGGTGATGGCAACCGATTCGATTTCTCGAGAAATCGAATCGGTTGCCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_146252.2-591s21c1
Sequence:CCGGCATCAGCCCTGAACGAGTATGCTCGAGCATACTCGTTCAGGGCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_146252.2-402s21c1
Sequence:CCGGGGAGGTTGTGCCCAGATATATCTCGAGATATATCTGGGCACAACCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_146252.2-654s21c1
Sequence:CCGGAGCGCATCCTGTTCATCTATGCTCGAGCATAGATGAACAGGATGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257953    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_146252.2-3002s21c1
Sequence:CCGGTTACCCTAGAGCCGAGTATAACTCGAGTTATACTCGGCTCTAGGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146252
VALIDATED
TBC1D13 MISSION shRNA shRNA Plasmid DNA
TBC1 domain family, member 13
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183468    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_146252.1-2549s1c1
Sequence:CCGGGCTTGATCTATCTTCTGACTTCTCGAGAAGTCAGAAGATAGATCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179787    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146252.1-972s1c1
Sequence:CCGGGAGTATCAAGCCTCAGTTCTTCTCGAGAAGAACTGAGGCTTGATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216876    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146252.2-235s1c1
Sequence:CCGGGTTCCTGAGAGAGATGATTATCTCGAGATAATCATCTCTCTCAGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_146252.2-1048s21c1
Sequence:CCGGTGATGGCAACCGATTCGATTTCTCGAGAAATCGAATCGGTTGCCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_146252.2-591s21c1
Sequence:CCGGCATCAGCCCTGAACGAGTATGCTCGAGCATACTCGTTCAGGGCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_146252.2-402s21c1
Sequence:CCGGGGAGGTTGTGCCCAGATATATCTCGAGATATATCTGGGCACAACCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_146252.2-654s21c1
Sequence:CCGGAGCGCATCCTGTTCATCTATGCTCGAGCATAGATGAACAGGATGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257953    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_146252.2-3002s21c1
Sequence:CCGGTTACCCTAGAGCCGAGTATAACTCGAGTTATACTCGGCTCTAGGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146252
VALIDATED
TBC1D13 MISSION shRNA Lentiviral Transduction Particles
TBC1 domain family, member 13
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183468    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_146252.1-2549s1c1
Sequence:CCGGGCTTGATCTATCTTCTGACTTCTCGAGAAGTCAGAAGATAGATCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179787    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146252.1-972s1c1
Sequence:CCGGGAGTATCAAGCCTCAGTTCTTCTCGAGAAGAACTGAGGCTTGATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216876    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146252.2-235s1c1
Sequence:CCGGGTTCCTGAGAGAGATGATTATCTCGAGATAATCATCTCTCTCAGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_146252.2-1048s21c1
Sequence:CCGGTGATGGCAACCGATTCGATTTCTCGAGAAATCGAATCGGTTGCCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_146252.2-591s21c1
Sequence:CCGGCATCAGCCCTGAACGAGTATGCTCGAGCATACTCGTTCAGGGCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_146252.2-402s21c1
Sequence:CCGGGGAGGTTGTGCCCAGATATATCTCGAGATATATCTGGGCACAACCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_146252.2-654s21c1
Sequence:CCGGAGCGCATCCTGTTCATCTATGCTCGAGCATAGATGAACAGGATGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257953    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_146252.2-3002s21c1
Sequence:CCGGTTACCCTAGAGCCGAGTATAACTCGAGTTATACTCGGCTCTAGGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018201
TBC1D13 MISSION shRNA Bacterial Glycerol Stock
TBC1 domain family, member 13
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018201.2-1051s1c1
Sequence:CCGGCGATGACAACCGCTTTGACTTCTCGAGAAGTCAAAGCGGTTGTCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018201.2-934s1c1
Sequence:CCGGGAAACTGCAAGAGCAGAACATCTCGAGATGTTCTGCTCTTGCAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135970    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018201.2-2923s1c1
Sequence:CCGGGCACAGTATTTGGGAGACTTTCTCGAGAAAGTCTCCCAAATACTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135840    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018201.2-3383s1c1
Sequence:CCGGCCACACTACTTGAATCACCATCTCGAGATGGTGATTCAAGTAGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018201.2-352s1c1
Sequence:CCGGGAACACGTACTTCAAGGACAACTCGAGTTGTCCTTGAAGTACGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135458    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018201.2-706s1c1
Sequence:CCGGGCAAGGCATGAATGAAATCGTCTCGAGACGATTTCATTCATGCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018201.3-166s21c1
Sequence:CCGGGTCCTGAAGGAGCCCTCAATTCTCGAGAATTGAGGGCTCCTTCAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018201.3-583s21c1
Sequence:CCGGGAGTTTGAAACCCTTCGTAAGCTCGAGCTTACGAAGGGTTTCAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018201.3-992s21c1
Sequence:CCGGAGGTTTACTCCACCTTGAAAGCTCGAGCTTTCAAGGTGGAGTAAACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018201
TBC1D13 MISSION shRNA shRNA Plasmid DNA
TBC1 domain family, member 13
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018201.2-1051s1c1
Sequence:CCGGCGATGACAACCGCTTTGACTTCTCGAGAAGTCAAAGCGGTTGTCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018201.2-934s1c1
Sequence:CCGGGAAACTGCAAGAGCAGAACATCTCGAGATGTTCTGCTCTTGCAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135970    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018201.2-2923s1c1
Sequence:CCGGGCACAGTATTTGGGAGACTTTCTCGAGAAAGTCTCCCAAATACTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135840    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018201.2-3383s1c1
Sequence:CCGGCCACACTACTTGAATCACCATCTCGAGATGGTGATTCAAGTAGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018201.2-352s1c1
Sequence:CCGGGAACACGTACTTCAAGGACAACTCGAGTTGTCCTTGAAGTACGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135458    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018201.2-706s1c1
Sequence:CCGGGCAAGGCATGAATGAAATCGTCTCGAGACGATTTCATTCATGCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018201.3-166s21c1
Sequence:CCGGGTCCTGAAGGAGCCCTCAATTCTCGAGAATTGAGGGCTCCTTCAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018201.3-583s21c1
Sequence:CCGGGAGTTTGAAACCCTTCGTAAGCTCGAGCTTACGAAGGGTTTCAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018201.3-992s21c1
Sequence:CCGGAGGTTTACTCCACCTTGAAAGCTCGAGCTTTCAAGGTGGAGTAAACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018201
TBC1D13 MISSION shRNA Lentiviral Transduction Particles
TBC1 domain family, member 13
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018201.2-1051s1c1
Sequence:CCGGCGATGACAACCGCTTTGACTTCTCGAGAAGTCAAAGCGGTTGTCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018201.2-934s1c1
Sequence:CCGGGAAACTGCAAGAGCAGAACATCTCGAGATGTTCTGCTCTTGCAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135970    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018201.2-2923s1c1
Sequence:CCGGGCACAGTATTTGGGAGACTTTCTCGAGAAAGTCTCCCAAATACTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135840    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018201.2-3383s1c1
Sequence:CCGGCCACACTACTTGAATCACCATCTCGAGATGGTGATTCAAGTAGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018201.2-352s1c1
Sequence:CCGGGAACACGTACTTCAAGGACAACTCGAGTTGTCCTTGAAGTACGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135458    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018201.2-706s1c1
Sequence:CCGGGCAAGGCATGAATGAAATCGTCTCGAGACGATTTCATTCATGCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018201.3-166s21c1
Sequence:CCGGGTCCTGAAGGAGCCCTCAATTCTCGAGAATTGAGGGCTCCTTCAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018201.3-583s21c1
Sequence:CCGGGAGTTTGAAACCCTTCGTAAGCTCGAGCTTACGAAGGGTTTCAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018201.3-992s21c1
Sequence:CCGGAGGTTTACTCCACCTTGAAAGCTCGAGCTTTCAAGGTGGAGTAAACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks