EMAIL THIS PAGE TO A FRIEND

TBC1D14

TBC1 domain family, member 14

UniProtKB ID: Q9P2M4, B9A6L5, D3DVT4, E9PAZ6, Q8IW15, Q8NDK3
Gene ID:
Mouse(100855) TBC1 domain family, member 14
Rat(360956) TBC1 domain family, member 14
cow(618286) TBC1 domain family, member 14
sheep(101118104) TBC1 domain family, member 14
domestic guinea pig(100715836) TBC1 domain family, member 14
naked mole-rat(101714273) TBC1 domain family, member 14
Domestic Rabbit(100345142) TBC1 domain family, member 14
Zebrafish(557744) TBC1 domain family, member 14
chicken(422862) TBC1 domain family, member 14
dog(488781) TBC1 domain family, member 14
Horse(100070312) TBC1 domain family, member 14
domestic cat(101099295) TBC1 domain family, member 14
172 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020773 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020773 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020773 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133910 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133910 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133910 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001113361 Rosetta Predictions human pricing
NM_001113363 Rosetta Predictions human pricing
NM_020773 Rosetta Predictions human pricing
NM_001012152 Rosetta Predictions rat pricing
NM_001034021 Rosetta Predictions rat pricing
NM_001113365 Rosetta Predictions rat pricing
NM_001113362 Rosetta Predictions mouse pricing
NM_001113364 Rosetta Predictions mouse pricing
NM_133910 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113361 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00325731 predicted 1768
2 SASI_Hs02_00325732 predicted 1199
3 SASI_Hs02_00325733 predicted 1238
4 SASI_Hs02_00325734 predicted 1808
5 SASI_Hs02_00325735 predicted 1772
6 SASI_Hs02_00325736 predicted 1523
7 SASI_Hs02_00325737 predicted 1969
8 SASI_Hs02_00325738 predicted 1778
9 SASI_Hs02_00325739 predicted 1529
10 SASI_Hs02_00325740 predicted 1481
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113363 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00325741 predicted 1034
2 SASI_Hs02_00325742 predicted 469
3 SASI_Hs02_00325743 predicted 496
4 SASI_Hs02_00325744 predicted 1079
5 SASI_Hs02_00325745 predicted 1035
6 SASI_Hs02_00325746 predicted 789
7 SASI_Hs02_00325747 predicted 1234
8 SASI_Hs02_00325748 predicted 1045
9 SASI_Hs02_00325749 predicted 799
10 SASI_Hs02_00325750 predicted 745
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020773 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00026394 predicted 1895
2 SASI_Hs01_00026396 predicted 1324
3 SASI_Hs01_00026397 predicted 1359
4 SASI_Hs01_00026401 predicted 1932
5 SASI_Hs02_00353907 predicted 1895
6 SASI_Hs01_00026402 predicted 1649
7 SASI_Hs01_00026403 predicted 2086
8 SASI_Hs02_00353908 predicted 1907
9 SASI_Hs02_00353909 predicted 1658
10 SASI_Hs02_00353910 predicted 1604
11 SASI_Hs01_00026395 predicted 520
12 SASI_Hs01_00026398 predicted 843
13 SASI_Hs01_00026399 predicted 1088
14 SASI_Hs01_00026400 predicted 1140
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012152 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00049197 predicted 926
2 SASI_Rn02_00200331 predicted 683
3 SASI_Rn02_00200332 predicted 979
4 SASI_Rn02_00200333 predicted 450
5 SASI_Rn02_00200334 predicted 1431
6 SASI_Rn02_00200335 predicted 735
7 SASI_Rn02_00200336 predicted 495
8 SASI_Rn01_00049200 predicted 1101
9 SASI_Rn02_00200337 predicted 745
10 SASI_Rn02_00200338 predicted 1027
11 SASI_Rn01_00049194 predicted 796
12 SASI_Rn01_00049195 predicted 1572
13 SASI_Rn01_00049196 predicted 926
14 SASI_Rn01_00049198 predicted 876
15 SASI_Rn01_00049199 predicted 976
16 SASI_Rn01_00049201 predicted 1051
17 SASI_Rn01_00049202 predicted 1059
18 SASI_Rn01_00049203 predicted 998
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034021 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00079784 predicted 1791
2 SASI_Rn02_00203899 predicted 1841
3 SASI_Rn02_00203900 predicted 1321
4 SASI_Rn02_00203901 predicted 2291
5 SASI_Rn02_00203902 predicted 1598
6 SASI_Rn02_00203903 predicted 1361
7 SASI_Rn01_00079787 predicted 1959
8 SASI_Rn02_00203904 predicted 1604
9 SASI_Rn02_00203905 predicted 1884
10 SASI_Rn02_00203906 predicted 1879
11 SASI_Rn01_00079781 predicted 1695
12 SASI_Rn01_00079782 predicted 2462
13 SASI_Rn01_00079783 predicted 1827
14 SASI_Rn01_00079785 predicted 1775
15 SASI_Rn01_00079786 predicted 1868
16 SASI_Rn01_00079788 predicted 1956
17 SASI_Rn01_00079789 predicted 1962
18 SASI_Rn01_00079790 predicted 1904
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113365 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00251753 predicted 2015
2 SASI_Rn02_00251754 predicted 2069
3 SASI_Rn02_00251755 predicted 1546
4 SASI_Rn02_00251756 predicted 2515
5 SASI_Rn02_00251757 predicted 1825
6 SASI_Rn02_00251758 predicted 1584
7 SASI_Rn02_00251759 predicted 2188
8 SASI_Rn02_00251760 predicted 1838
9 SASI_Rn02_00251761 predicted 2109
10 SASI_Rn02_00251762 predicted 2109
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113362 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00307508 predicted 1881
2 SASI_Mm02_00307509 predicted 1636
3 SASI_Mm02_00307510 predicted 1979
4 SASI_Mm02_00307511 predicted 1691
5 SASI_Mm02_00307512 predicted 1930
6 SASI_Mm02_00307513 predicted 1407
7 SASI_Mm02_00307514 predicted 1697
8 SASI_Mm02_00307515 predicted 1450
9 SASI_Mm02_00307516 predicted 1646
10 SASI_Mm02_00307517 predicted 1408
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113364 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00307518 predicted 997
2 SASI_Mm02_00307519 predicted 743
3 SASI_Mm02_00307520 predicted 1092
4 SASI_Mm02_00307521 predicted 805
5 SASI_Mm02_00307522 predicted 1046
6 SASI_Mm02_00307523 predicted 524
7 SASI_Mm02_00307524 predicted 810
8 SASI_Mm02_00307525 predicted 566
9 SASI_Mm02_00307526 predicted 756
10 SASI_Mm02_00307527 predicted 528
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133910 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00102114 predicted 1699
2 SASI_Mm02_00338967 predicted 1448
3 SASI_Mm01_00102116 predicted 1799
4 SASI_Mm01_00102118 predicted 1508
5 SASI_Mm01_00102119 predicted 1750
6 SASI_Mm01_00102120 predicted 1225
7 SASI_Mm02_00338968 predicted 1518
8 SASI_Mm02_00338969 predicted 1273
9 SASI_Mm02_00338970 predicted 1461
10 SASI_Mm02_00338971 predicted 1230
11 SASI_Mm01_00102115 predicted 740
12 SASI_Mm01_00102117 predicted 756
13 SASI_Mm01_00102121 predicted 667
14 SASI_Mm01_00102122 predicted 679
15 SASI_Mm01_00102123 predicted 1870
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020773
VALIDATED
TBC1D14 MISSION shRNA Bacterial Glycerol Stock
TBC1 domain family, member 14
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377457    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020773.2-2369s21c1
Sequence:CCGGGAGAAGAACAGACGCTCTTTACTCGAGTAAAGAGCGTCTGTTCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020773.2-236s21c1
Sequence:CCGGGCGTAGCCTTCATGGGTATTCCTCGAGGAATACCCATGAAGGCTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020773.2-1581s21c1
Sequence:CCGGAGCCAGTCTGGAGCTTATTAACTCGAGTTAATAAGCTCCAGACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020773.2-1439s21c1
Sequence:CCGGTAGCCATTGGCAACGAGTTAACTCGAGTTAACTCGTTGCCAATGGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365109    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020773.2-2672s21c1
Sequence:CCGGGAGATGCTTTGGCTGATATTTCTCGAGAAATATCAGCCAAAGCATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020773.2-1934s21c1
Sequence:CCGGCTCCAGATATCTACCTAATTGCTCGAGCAATTAGGTAGATATCTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020773.1-1365s1c1
Sequence:CCGGCCATTGGCAACGAGTTAAATACTCGAGTATTTAACTCGTTGCCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020773.1-1763s1c1
Sequence:CCGGCATGGCCTTATGTTGACTTATCTCGAGATAAGTCAACATAAGGCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020773.1-940s1c1
Sequence:CCGGCCAGAAGGATTCAAAGAGAATCTCGAGATTCTCTTTGAATCCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020773.1-1667s1c1
Sequence:CCGGGCAGTGTTGATCTTGAACTTACTCGAGTAAGTTCAAGATCAACACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020773
VALIDATED
TBC1D14 MISSION shRNA shRNA Plasmid DNA
TBC1 domain family, member 14
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377457    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020773.2-2369s21c1
Sequence:CCGGGAGAAGAACAGACGCTCTTTACTCGAGTAAAGAGCGTCTGTTCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020773.2-236s21c1
Sequence:CCGGGCGTAGCCTTCATGGGTATTCCTCGAGGAATACCCATGAAGGCTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020773.2-1581s21c1
Sequence:CCGGAGCCAGTCTGGAGCTTATTAACTCGAGTTAATAAGCTCCAGACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020773.2-1439s21c1
Sequence:CCGGTAGCCATTGGCAACGAGTTAACTCGAGTTAACTCGTTGCCAATGGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365109    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020773.2-2672s21c1
Sequence:CCGGGAGATGCTTTGGCTGATATTTCTCGAGAAATATCAGCCAAAGCATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020773.2-1934s21c1
Sequence:CCGGCTCCAGATATCTACCTAATTGCTCGAGCAATTAGGTAGATATCTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020773.1-1365s1c1
Sequence:CCGGCCATTGGCAACGAGTTAAATACTCGAGTATTTAACTCGTTGCCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020773.1-1763s1c1
Sequence:CCGGCATGGCCTTATGTTGACTTATCTCGAGATAAGTCAACATAAGGCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020773.1-940s1c1
Sequence:CCGGCCAGAAGGATTCAAAGAGAATCTCGAGATTCTCTTTGAATCCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020773.1-1667s1c1
Sequence:CCGGGCAGTGTTGATCTTGAACTTACTCGAGTAAGTTCAAGATCAACACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020773
VALIDATED
TBC1D14 MISSION shRNA Lentiviral Transduction Particles
TBC1 domain family, member 14
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377457    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020773.2-2369s21c1
Sequence:CCGGGAGAAGAACAGACGCTCTTTACTCGAGTAAAGAGCGTCTGTTCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020773.2-236s21c1
Sequence:CCGGGCGTAGCCTTCATGGGTATTCCTCGAGGAATACCCATGAAGGCTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020773.2-1581s21c1
Sequence:CCGGAGCCAGTCTGGAGCTTATTAACTCGAGTTAATAAGCTCCAGACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020773.2-1439s21c1
Sequence:CCGGTAGCCATTGGCAACGAGTTAACTCGAGTTAACTCGTTGCCAATGGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365109    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020773.2-2672s21c1
Sequence:CCGGGAGATGCTTTGGCTGATATTTCTCGAGAAATATCAGCCAAAGCATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020773.2-1934s21c1
Sequence:CCGGCTCCAGATATCTACCTAATTGCTCGAGCAATTAGGTAGATATCTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020773.1-1365s1c1
Sequence:CCGGCCATTGGCAACGAGTTAAATACTCGAGTATTTAACTCGTTGCCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020773.1-1763s1c1
Sequence:CCGGCATGGCCTTATGTTGACTTATCTCGAGATAAGTCAACATAAGGCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020773.1-940s1c1
Sequence:CCGGCCAGAAGGATTCAAAGAGAATCTCGAGATTCTCTTTGAATCCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020773.1-1667s1c1
Sequence:CCGGGCAGTGTTGATCTTGAACTTACTCGAGTAAGTTCAAGATCAACACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133910
VALIDATED
TBC1D14 MISSION shRNA Bacterial Glycerol Stock
TBC1 domain family, member 14
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000276753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133910.3-1442s21c1
Sequence:CCGGAGGCCAGTCTGGAGCTTATTACTCGAGTAATAAGCTCCAGACTGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276752    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133910.3-2580s21c1
Sequence:CCGGCCAGAGATGAAAGGTGTGTTTCTCGAGAAACACACCTTTCATCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133910.3-610s21c1
Sequence:CCGGACGAGCAATTCCAGCGCTATTCTCGAGAATAGCGCTGGAATTGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133910.3-1798s21c1
Sequence:CCGGGCAGATATCTACCTAATCGATCTCGAGATCGATTAGGTAGATATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133910.3-1758s21c1
Sequence:CCGGGCCGAAATTGTTTGCGCATTTCTCGAGAAATGCGCAAACAATTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176416    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133910.2-2556s1c1
Sequence:CCGGCCAGAGATGAAAGGTGTGTTTCTCGAGAAACACACCTTTCATCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133910.2-792s1c1
Sequence:CCGGGCTTGATAGACAGAGAGACTTCTCGAGAAGTCTCTCTGTCTATCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133910.2-155s1c1
Sequence:CCGGGATCCCTTTCAGTGCCTGAATCTCGAGATTCAGGCACTGAAAGGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133910.2-1734s1c1
Sequence:CCGGGCCGAAATTGTTTGCGCATTTCTCGAGAAATGCGCAAACAATTTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133910.2-1774s1c1
Sequence:CCGGGCAGATATCTACCTAATCGATCTCGAGATCGATTAGGTAGATATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133910
VALIDATED
TBC1D14 MISSION shRNA shRNA Plasmid DNA
TBC1 domain family, member 14
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000276753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133910.3-1442s21c1
Sequence:CCGGAGGCCAGTCTGGAGCTTATTACTCGAGTAATAAGCTCCAGACTGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276752    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133910.3-2580s21c1
Sequence:CCGGCCAGAGATGAAAGGTGTGTTTCTCGAGAAACACACCTTTCATCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133910.3-610s21c1
Sequence:CCGGACGAGCAATTCCAGCGCTATTCTCGAGAATAGCGCTGGAATTGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133910.3-1798s21c1
Sequence:CCGGGCAGATATCTACCTAATCGATCTCGAGATCGATTAGGTAGATATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133910.3-1758s21c1
Sequence:CCGGGCCGAAATTGTTTGCGCATTTCTCGAGAAATGCGCAAACAATTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176416    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133910.2-2556s1c1
Sequence:CCGGCCAGAGATGAAAGGTGTGTTTCTCGAGAAACACACCTTTCATCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133910.2-792s1c1
Sequence:CCGGGCTTGATAGACAGAGAGACTTCTCGAGAAGTCTCTCTGTCTATCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133910.2-155s1c1
Sequence:CCGGGATCCCTTTCAGTGCCTGAATCTCGAGATTCAGGCACTGAAAGGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133910.2-1734s1c1
Sequence:CCGGGCCGAAATTGTTTGCGCATTTCTCGAGAAATGCGCAAACAATTTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133910.2-1774s1c1
Sequence:CCGGGCAGATATCTACCTAATCGATCTCGAGATCGATTAGGTAGATATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133910
VALIDATED
TBC1D14 MISSION shRNA Lentiviral Transduction Particles
TBC1 domain family, member 14
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000276753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133910.3-1442s21c1
Sequence:CCGGAGGCCAGTCTGGAGCTTATTACTCGAGTAATAAGCTCCAGACTGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276752    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133910.3-2580s21c1
Sequence:CCGGCCAGAGATGAAAGGTGTGTTTCTCGAGAAACACACCTTTCATCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133910.3-610s21c1
Sequence:CCGGACGAGCAATTCCAGCGCTATTCTCGAGAATAGCGCTGGAATTGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133910.3-1798s21c1
Sequence:CCGGGCAGATATCTACCTAATCGATCTCGAGATCGATTAGGTAGATATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133910.3-1758s21c1
Sequence:CCGGGCCGAAATTGTTTGCGCATTTCTCGAGAAATGCGCAAACAATTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176416    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133910.2-2556s1c1
Sequence:CCGGCCAGAGATGAAAGGTGTGTTTCTCGAGAAACACACCTTTCATCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133910.2-792s1c1
Sequence:CCGGGCTTGATAGACAGAGAGACTTCTCGAGAAGTCTCTCTGTCTATCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133910.2-155s1c1
Sequence:CCGGGATCCCTTTCAGTGCCTGAATCTCGAGATTCAGGCACTGAAAGGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133910.2-1734s1c1
Sequence:CCGGGCCGAAATTGTTTGCGCATTTCTCGAGAAATGCGCAAACAATTTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133910.2-1774s1c1
Sequence:CCGGGCAGATATCTACCTAATCGATCTCGAGATCGATTAGGTAGATATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks