EMAIL THIS PAGE TO A FRIEND

TBC1D15

TBC1 domain family, member 15

Synonyms: RAB7-GAP
UniProtKB ID: Q8TC07, B4DMT9, B9A6L6, J3KNI9, Q9HA83
Gene ID:
Human(64786) Summary: This gene encodes a member of the Ras-like proteins in brain-GTPase activating protein superfamily that share a conserved Tre-2/Bub2/Cdc16 domain. The encoded protein interacts with Ras-like protein in brain 5A and may function as a regulator of intracellular trafficking. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Apr 2009]
Mouse(66687) TBC1 domain family, member 15
Rat(366896) TBC1 domain family, member 15
Zebrafish(492676) TBC1 domain family, member 15
Horse(100056891) TBC1 domain family, member 15
domestic cat(101081740) TBC1 domain family, member 15
dog(474451) TBC1 domain family, member 15
chicken(417857) TBC1 domain family, member 15
naked mole-rat(101714958) TBC1 domain family, member 15
domestic guinea pig(100718333) TBC1 domain family, member 15
cow(534252) TBC1 domain family, member 15
sheep(101122098) TBC1 domain family, member 15
141 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025706 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025706 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025706 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022771 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022771 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022771 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU008041 MISSION® esiRNA esiRNA targeting human TBC1D15 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022771 Rosetta Predictions human pricing
XM_001078627 Rosetta Predictions rat pricing
XM_345825 Rosetta Predictions rat pricing
NM_025706 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022771 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00100432 predicted 1523
2 SASI_Hs01_00100433 predicted 393
3 SASI_Hs02_00356062 predicted 1836
4 SASI_Hs01_00100434 predicted 465
5 SASI_Hs01_00100435 predicted 2079
6 SASI_Hs01_00100436 predicted 1998
7 SASI_Hs01_00100437 predicted 1230
8 SASI_Hs01_00100438 predicted 1677
9 SASI_Hs01_00100440 predicted 304
10 SASI_Hs02_00356063 predicted 1919
11 SASI_Hs01_00100431 predicted 1092
12 SASI_Hs01_00100439 predicted 326
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078627 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00361507 predicted 1334
2 SASI_Rn02_00361508 predicted 2132
3 SASI_Rn02_00361509 predicted 209
4 SASI_Rn02_00361510 predicted 866
5 SASI_Rn02_00361511 predicted 1236
6 SASI_Rn02_00361512 predicted 594
7 SASI_Rn02_00361513 predicted 845
8 SASI_Rn02_00361514 predicted 1062
9 SASI_Rn02_00361515 predicted 1494
10 SASI_Rn02_00361516 predicted 2088
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_345825 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00398708 predicted 1330
2 SASI_Rn02_00398709 predicted 2134
3 SASI_Rn02_00398710 predicted 206
4 SASI_Rn02_00398711 predicted 871
5 SASI_Rn02_00398712 predicted 1238
6 SASI_Rn02_00398713 predicted 585
7 SASI_Rn02_00398714 predicted 843
8 SASI_Rn02_00398715 predicted 1063
9 SASI_Rn02_00398716 predicted 1494
10 SASI_Rn02_00398717 predicted 2088
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025706 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00125107 predicted 1754
2 SASI_Mm01_00125108 predicted 1048
3 SASI_Mm01_00125109 predicted 1746
4 SASI_Mm01_00125110 predicted 1328
5 SASI_Mm01_00125111 predicted 333
6 SASI_Mm01_00125112 predicted 2074
7 SASI_Mm01_00125113 predicted 632
8 SASI_Mm01_00125114 predicted 2130
9 SASI_Mm01_00125116 predicted 1856
10 SASI_Mm02_00328876 predicted 2156
11 SASI_Mm01_00125115 predicted 561
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025706
VALIDATED
TBC1D15 MISSION shRNA Bacterial Glycerol Stock
TBC1 domain family, member 15
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000181470    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025706.2-135s1c1
Sequence:CCGGCGGAAAGGCAAATGACCAAGACTCGAGTCTTGGTCATTTGCCTTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178016    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025706.2-1779s1c1
Sequence:CCGGGCACATCAATGAGTTGTCCATCTCGAGATGGACAACTCATTGATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176593    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025706.2-640s1c1
Sequence:CCGGCTTCTAGTCAATTGTCAGAATCTCGAGATTCTGACAATTGACTAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025706.2-1310s21c1
Sequence:CCGGTGATTCTGCTTCACGACATTTCTCGAGAAATGTCGTGAAGCAGAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216709    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025706.2-1648s1c1
Sequence:CCGGCTTCGATTATGGGAGGTAATGCTCGAGCATTACCTCCCATAATCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217350    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025706.2-2329s1c1
Sequence:CCGGGATGAACTGGGATTGGATAAACTCGAGTTTATCCAATCCCAGTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250025    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025706.2-2869s21c1
Sequence:CCGGCCTGTCTATACCTGGTATAAACTCGAGTTTATACCAGGTATAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025706.2-1638s21c1
Sequence:CCGGTCTAGATATACTTCGATTATGCTCGAGCATAATCGAAGTATATCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025706.2-2065s21c1
Sequence:CCGGTTAACACCTGCATGATCATTTCTCGAGAAATGATCATGCAGGTGTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025706.2-1490s21c1
Sequence:CCGGAGGGCATGAAGACGCAGTTAACTCGAGTTAACTGCGTCTTCATGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025706
VALIDATED
TBC1D15 MISSION shRNA shRNA Plasmid DNA
TBC1 domain family, member 15
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000181470    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025706.2-135s1c1
Sequence:CCGGCGGAAAGGCAAATGACCAAGACTCGAGTCTTGGTCATTTGCCTTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178016    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025706.2-1779s1c1
Sequence:CCGGGCACATCAATGAGTTGTCCATCTCGAGATGGACAACTCATTGATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176593    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025706.2-640s1c1
Sequence:CCGGCTTCTAGTCAATTGTCAGAATCTCGAGATTCTGACAATTGACTAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025706.2-1310s21c1
Sequence:CCGGTGATTCTGCTTCACGACATTTCTCGAGAAATGTCGTGAAGCAGAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216709    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025706.2-1648s1c1
Sequence:CCGGCTTCGATTATGGGAGGTAATGCTCGAGCATTACCTCCCATAATCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217350    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025706.2-2329s1c1
Sequence:CCGGGATGAACTGGGATTGGATAAACTCGAGTTTATCCAATCCCAGTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250025    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025706.2-2869s21c1
Sequence:CCGGCCTGTCTATACCTGGTATAAACTCGAGTTTATACCAGGTATAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025706.2-1638s21c1
Sequence:CCGGTCTAGATATACTTCGATTATGCTCGAGCATAATCGAAGTATATCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025706.2-2065s21c1
Sequence:CCGGTTAACACCTGCATGATCATTTCTCGAGAAATGATCATGCAGGTGTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025706.2-1490s21c1
Sequence:CCGGAGGGCATGAAGACGCAGTTAACTCGAGTTAACTGCGTCTTCATGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025706
VALIDATED
TBC1D15 MISSION shRNA Lentiviral Transduction Particles
TBC1 domain family, member 15
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000181470    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025706.2-135s1c1
Sequence:CCGGCGGAAAGGCAAATGACCAAGACTCGAGTCTTGGTCATTTGCCTTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178016    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025706.2-1779s1c1
Sequence:CCGGGCACATCAATGAGTTGTCCATCTCGAGATGGACAACTCATTGATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176593    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025706.2-640s1c1
Sequence:CCGGCTTCTAGTCAATTGTCAGAATCTCGAGATTCTGACAATTGACTAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025706.2-1310s21c1
Sequence:CCGGTGATTCTGCTTCACGACATTTCTCGAGAAATGTCGTGAAGCAGAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216709    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025706.2-1648s1c1
Sequence:CCGGCTTCGATTATGGGAGGTAATGCTCGAGCATTACCTCCCATAATCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217350    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025706.2-2329s1c1
Sequence:CCGGGATGAACTGGGATTGGATAAACTCGAGTTTATCCAATCCCAGTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250025    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025706.2-2869s21c1
Sequence:CCGGCCTGTCTATACCTGGTATAAACTCGAGTTTATACCAGGTATAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025706.2-1638s21c1
Sequence:CCGGTCTAGATATACTTCGATTATGCTCGAGCATAATCGAAGTATATCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025706.2-2065s21c1
Sequence:CCGGTTAACACCTGCATGATCATTTCTCGAGAAATGATCATGCAGGTGTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025706.2-1490s21c1
Sequence:CCGGAGGGCATGAAGACGCAGTTAACTCGAGTTAACTGCGTCTTCATGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022771
VALIDATED
TBC1D15 MISSION shRNA Bacterial Glycerol Stock
TBC1 domain family, member 15
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155787    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022771.3-2055s1c1
Sequence:CCGGCAGATACCAGTGTCCTCAGATCTCGAGATCTGAGGACACTGGTATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150682    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022771.3-2874s1c1
Sequence:CCGGGAGATTATGTTCAACCCTGTACTCGAGTACAGGGTTGAACATAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_022771.3-1542s1c1
Sequence:CCGGCGATTGTTAGACAGTGGATTTCTCGAGAAATCCACTGTCTAACAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152174    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022771.3-372s1c1
Sequence:CCGGCCAAGTCATAGAAATGGGAAACTCGAGTTTCCCATTTCTATGACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022771.3-1684s1c1
Sequence:CCGGCCGAACTACCATGTACAAATTCTCGAGAATTTGTACATGGTAGTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_022771.3-1671s1c1
Sequence:CCGGGAGGTAATGTGGACCGAACTACTCGAGTAGTTCGGTCCACATTACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155572    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022771.3-407s1c1
Sequence:CCGGCCTGTTCAGTTTGACAGACCTCTCGAGAGGTCTGTCAAACTGAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022771.3-1935s1c1
Sequence:CCGGCCAGATTCAGACGTTGGTGAACTCGAGTTCACCAACGTCTGAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231966    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022771.3-2661s21c1
Sequence:CCGGTAAGTGGATTGGCAGTATATTCTCGAGAATATACTGCCAATCCACTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_022771.3-1649s21c1
Sequence:CCGGTCTAGATATTCTTCGATTATGCTCGAGCATAATCGAAGAATATCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_022771.3-452s21c1
Sequence:CCGGGGGTATGGGCTGGTCCTATTTCTCGAGAAATAGGACCAGCCCATACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_022771.3-192s21c1
Sequence:CCGGGCATTAGATTCCTCTAGTATTCTCGAGAATACTAGAGGAATCTAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_022771.3-106s21c1
Sequence:CCGGATGACCAAGACGGCTTGATTTCTCGAGAAATCAAGCCGTCTTGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022771
VALIDATED
TBC1D15 MISSION shRNA shRNA Plasmid DNA
TBC1 domain family, member 15
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155787    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022771.3-2055s1c1
Sequence:CCGGCAGATACCAGTGTCCTCAGATCTCGAGATCTGAGGACACTGGTATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150682    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022771.3-2874s1c1
Sequence:CCGGGAGATTATGTTCAACCCTGTACTCGAGTACAGGGTTGAACATAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_022771.3-1542s1c1
Sequence:CCGGCGATTGTTAGACAGTGGATTTCTCGAGAAATCCACTGTCTAACAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152174    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022771.3-372s1c1
Sequence:CCGGCCAAGTCATAGAAATGGGAAACTCGAGTTTCCCATTTCTATGACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022771.3-1684s1c1
Sequence:CCGGCCGAACTACCATGTACAAATTCTCGAGAATTTGTACATGGTAGTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_022771.3-1671s1c1
Sequence:CCGGGAGGTAATGTGGACCGAACTACTCGAGTAGTTCGGTCCACATTACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155572    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022771.3-407s1c1
Sequence:CCGGCCTGTTCAGTTTGACAGACCTCTCGAGAGGTCTGTCAAACTGAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022771.3-1935s1c1
Sequence:CCGGCCAGATTCAGACGTTGGTGAACTCGAGTTCACCAACGTCTGAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231966    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022771.3-2661s21c1
Sequence:CCGGTAAGTGGATTGGCAGTATATTCTCGAGAATATACTGCCAATCCACTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_022771.3-1649s21c1
Sequence:CCGGTCTAGATATTCTTCGATTATGCTCGAGCATAATCGAAGAATATCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_022771.3-452s21c1
Sequence:CCGGGGGTATGGGCTGGTCCTATTTCTCGAGAAATAGGACCAGCCCATACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_022771.3-192s21c1
Sequence:CCGGGCATTAGATTCCTCTAGTATTCTCGAGAATACTAGAGGAATCTAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_022771.3-106s21c1
Sequence:CCGGATGACCAAGACGGCTTGATTTCTCGAGAAATCAAGCCGTCTTGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022771
VALIDATED
TBC1D15 MISSION shRNA Lentiviral Transduction Particles
TBC1 domain family, member 15
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155787    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022771.3-2055s1c1
Sequence:CCGGCAGATACCAGTGTCCTCAGATCTCGAGATCTGAGGACACTGGTATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150682    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022771.3-2874s1c1
Sequence:CCGGGAGATTATGTTCAACCCTGTACTCGAGTACAGGGTTGAACATAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_022771.3-1542s1c1
Sequence:CCGGCGATTGTTAGACAGTGGATTTCTCGAGAAATCCACTGTCTAACAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152174    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022771.3-372s1c1
Sequence:CCGGCCAAGTCATAGAAATGGGAAACTCGAGTTTCCCATTTCTATGACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022771.3-1684s1c1
Sequence:CCGGCCGAACTACCATGTACAAATTCTCGAGAATTTGTACATGGTAGTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_022771.3-1671s1c1
Sequence:CCGGGAGGTAATGTGGACCGAACTACTCGAGTAGTTCGGTCCACATTACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155572    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022771.3-407s1c1
Sequence:CCGGCCTGTTCAGTTTGACAGACCTCTCGAGAGGTCTGTCAAACTGAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022771.3-1935s1c1
Sequence:CCGGCCAGATTCAGACGTTGGTGAACTCGAGTTCACCAACGTCTGAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231966    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022771.3-2661s21c1
Sequence:CCGGTAAGTGGATTGGCAGTATATTCTCGAGAATATACTGCCAATCCACTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_022771.3-1649s21c1
Sequence:CCGGTCTAGATATTCTTCGATTATGCTCGAGCATAATCGAAGAATATCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_022771.3-452s21c1
Sequence:CCGGGGGTATGGGCTGGTCCTATTTCTCGAGAAATAGGACCAGCCCATACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_022771.3-192s21c1
Sequence:CCGGGCATTAGATTCCTCTAGTATTCTCGAGAATACTAGAGGAATCTAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_022771.3-106s21c1
Sequence:CCGGATGACCAAGACGGCTTGATTTCTCGAGAAATCAAGCCGTCTTGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks