EMAIL THIS PAGE TO A FRIEND

TBC1D16

TBC1 domain family, member 16

UniProtKB ID: Q8TBP0
Gene ID:
Mouse(207592) TBC1 domain family, member 16
Rat(303734) TBC1 domain family, member 16
Zebrafish(450056) TBC1 domain family, member 16
domestic cat(101093976) TBC1 domain family, member 16
Horse(100050342) TBC1 domain family, member 16
dog(483350) TBC1 domain family, member 16
chicken(768712) TBC1 domain family, member 16
cow(512099) TBC1 domain family, member 16
sheep(101110689) TBC1 domain family, member 16
domestic guinea pig(100727753) TBC1 domain family, member 16
naked mole-rat(101715871) TBC1 domain family, member 16
65 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019020 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019020 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019020 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172443 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172443 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172443 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019020 Rosetta Predictions human pricing
XM_221188 Rosetta Predictions rat pricing
XR_009498 Rosetta Predictions rat pricing
NM_172443 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019020 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00156721 predicted 780
2 SASI_Hs01_00156722 predicted 2509
3 SASI_Hs01_00156723 predicted 2127
4 SASI_Hs01_00156724 predicted 867
5 SASI_Hs01_00156725 predicted 291
6 SASI_Hs01_00156726 predicted 1780
7 SASI_Hs01_00156727 predicted 2171
8 SASI_Hs01_00156728 predicted 219
9 SASI_Hs02_00352550 predicted 305
10 SASI_Hs01_00156729 predicted 1766
11 SASI_Hs01_00156730 predicted 2546
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_221188 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00379914 predicted 2166
2 SASI_Rn02_00379915 predicted 2296
3 SASI_Rn02_00379916 predicted 331
4 SASI_Rn02_00379917 predicted 430
5 SASI_Rn02_00379918 predicted 817
6 SASI_Rn02_00379919 predicted 2445
7 SASI_Rn02_00379920 predicted 2072
8 SASI_Rn02_00379921 predicted 685
9 SASI_Rn02_00379922 predicted 1134
10 SASI_Rn02_00379923 predicted 2607
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_009498 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00167689 predicted 2135
2 SASI_Rn02_00419919 predicted 2269
3 SASI_Rn02_00419920 predicted 303
4 SASI_Rn02_00419921 predicted 767
5 SASI_Rn02_00419922 predicted 395
6 SASI_Rn02_00419923 predicted 788
7 SASI_Rn01_00167692 predicted 2035
8 SASI_Rn02_00419924 predicted 654
9 SASI_Rn02_00419925 predicted 1107
10 SASI_Rn02_00419926 predicted 1923
11 SASI_Rn01_00167690 predicted 2164
12 SASI_Rn01_00167691 predicted 2247
13 SASI_Rn01_00167693 predicted 1738
14 SASI_Rn01_00167694 predicted 1802
15 SASI_Rn01_00167695 predicted 1895
16 SASI_Rn01_00167696 predicted 2107
17 SASI_Rn01_00167697 predicted 1375
18 SASI_Rn01_00167698 predicted 241
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172443 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00343942 predicted 2166
2 SASI_Mm02_00343943 predicted 1634
3 SASI_Mm02_00343944 predicted 2269
4 SASI_Mm02_00343945 predicted 1820
5 SASI_Mm02_00343946 predicted 523
6 SASI_Mm02_00343947 predicted 444
7 SASI_Mm02_00343948 predicted 2066
8 SASI_Mm02_00343949 predicted 2525
9 SASI_Mm02_00343950 predicted 1396
10 SASI_Mm02_00343951 predicted 828
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019020
VALIDATED
TBC1D16 MISSION shRNA Bacterial Glycerol Stock
TBC1 domain family, member 16
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000294216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_019020.2-1546s21c1
Sequence:CCGGACAGAGCGTTCTGGCGTAATGCTCGAGCATTACGCCAGAACGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_019020.2-1169s21c1
Sequence:CCGGGTGGAAATACTGCACCGAGATCTCGAGATCTCGGTGCAGTATTTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286831    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019020.2-3067s21c1
Sequence:CCGGGCTTGTAATGTTTATCCGTTTCTCGAGAAACGGATAAACATTACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_019020.2-1490s21c1
Sequence:CCGGGCGAAAGGAGTACTCTGAGATCTCGAGATCTCAGAGTACTCCTTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_019020.2-1360s21c1
Sequence:CCGGACAAGCTGCGGAAGGCCATTTCTCGAGAAATGGCCTTCCGCAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061888    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019020.2-3067s1c1
Sequence:CCGGGCTTGTAATGTTTATCCGTTTCTCGAGAAACGGATAAACATTACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_019020.2-302s1c1
Sequence:CCGGCCTGTGCTTGTACATGGAGAACTCGAGTTCTCCATGTACAAGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_019020.2-1169s1c1
Sequence:CCGGGTGGAAATACTGCACCGAGATCTCGAGATCTCGGTGCAGTATTTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_019020.2-1490s1c1
Sequence:CCGGGCGAAAGGAGTACTCTGAGATCTCGAGATCTCAGAGTACTCCTTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_019020.2-224s1c1
Sequence:CCGGGATCATCTACTCCAAGAACAACTCGAGTTGTTCTTGGAGTAGATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019020
VALIDATED
TBC1D16 MISSION shRNA shRNA Plasmid DNA
TBC1 domain family, member 16
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000294216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_019020.2-1546s21c1
Sequence:CCGGACAGAGCGTTCTGGCGTAATGCTCGAGCATTACGCCAGAACGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_019020.2-1169s21c1
Sequence:CCGGGTGGAAATACTGCACCGAGATCTCGAGATCTCGGTGCAGTATTTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286831    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019020.2-3067s21c1
Sequence:CCGGGCTTGTAATGTTTATCCGTTTCTCGAGAAACGGATAAACATTACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_019020.2-1490s21c1
Sequence:CCGGGCGAAAGGAGTACTCTGAGATCTCGAGATCTCAGAGTACTCCTTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_019020.2-1360s21c1
Sequence:CCGGACAAGCTGCGGAAGGCCATTTCTCGAGAAATGGCCTTCCGCAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061888    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019020.2-3067s1c1
Sequence:CCGGGCTTGTAATGTTTATCCGTTTCTCGAGAAACGGATAAACATTACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_019020.2-302s1c1
Sequence:CCGGCCTGTGCTTGTACATGGAGAACTCGAGTTCTCCATGTACAAGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_019020.2-1169s1c1
Sequence:CCGGGTGGAAATACTGCACCGAGATCTCGAGATCTCGGTGCAGTATTTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_019020.2-1490s1c1
Sequence:CCGGGCGAAAGGAGTACTCTGAGATCTCGAGATCTCAGAGTACTCCTTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_019020.2-224s1c1
Sequence:CCGGGATCATCTACTCCAAGAACAACTCGAGTTGTTCTTGGAGTAGATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019020
VALIDATED
TBC1D16 MISSION shRNA Lentiviral Transduction Particles
TBC1 domain family, member 16
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000294216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_019020.2-1546s21c1
Sequence:CCGGACAGAGCGTTCTGGCGTAATGCTCGAGCATTACGCCAGAACGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_019020.2-1169s21c1
Sequence:CCGGGTGGAAATACTGCACCGAGATCTCGAGATCTCGGTGCAGTATTTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286831    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019020.2-3067s21c1
Sequence:CCGGGCTTGTAATGTTTATCCGTTTCTCGAGAAACGGATAAACATTACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_019020.2-1490s21c1
Sequence:CCGGGCGAAAGGAGTACTCTGAGATCTCGAGATCTCAGAGTACTCCTTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_019020.2-1360s21c1
Sequence:CCGGACAAGCTGCGGAAGGCCATTTCTCGAGAAATGGCCTTCCGCAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061888    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019020.2-3067s1c1
Sequence:CCGGGCTTGTAATGTTTATCCGTTTCTCGAGAAACGGATAAACATTACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_019020.2-302s1c1
Sequence:CCGGCCTGTGCTTGTACATGGAGAACTCGAGTTCTCCATGTACAAGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_019020.2-1169s1c1
Sequence:CCGGGTGGAAATACTGCACCGAGATCTCGAGATCTCGGTGCAGTATTTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_019020.2-1490s1c1
Sequence:CCGGGCGAAAGGAGTACTCTGAGATCTCGAGATCTCAGAGTACTCCTTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_019020.2-224s1c1
Sequence:CCGGGATCATCTACTCCAAGAACAACTCGAGTTGTTCTTGGAGTAGATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172443
TBC1D16 MISSION shRNA Bacterial Glycerol Stock
TBC1 domain family, member 16
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172443.1-1474s1c1
Sequence:CCGGGCTGCACTATTATAGCCACGACTCGAGTCGTGGCTATAATAGTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172443.1-2398s1c1
Sequence:CCGGCAAGCCTTCAAGAGAAGGCAACTCGAGTTGCCTTCTCTTGAAGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172443.1-1997s1c1
Sequence:CCGGCTCTGCTTCAAGCGAGAGTTTCTCGAGAAACTCTCGCTTGAAGCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172443.1-256s1c1
Sequence:CCGGCCTGGATGGAAAGGTCATCTACTCGAGTAGATGACCTTTCCATCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172443.1-1597s1c1
Sequence:CCGGCTTCTGGCGTAATGTGCAGTTCTCGAGAACTGCACATTACGCCAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172443
TBC1D16 MISSION shRNA shRNA Plasmid DNA
TBC1 domain family, member 16
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172443.1-1474s1c1
Sequence:CCGGGCTGCACTATTATAGCCACGACTCGAGTCGTGGCTATAATAGTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172443.1-2398s1c1
Sequence:CCGGCAAGCCTTCAAGAGAAGGCAACTCGAGTTGCCTTCTCTTGAAGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172443.1-1997s1c1
Sequence:CCGGCTCTGCTTCAAGCGAGAGTTTCTCGAGAAACTCTCGCTTGAAGCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172443.1-256s1c1
Sequence:CCGGCCTGGATGGAAAGGTCATCTACTCGAGTAGATGACCTTTCCATCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172443.1-1597s1c1
Sequence:CCGGCTTCTGGCGTAATGTGCAGTTCTCGAGAACTGCACATTACGCCAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172443
TBC1D16 MISSION shRNA Lentiviral Transduction Particles
TBC1 domain family, member 16
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172443.1-1474s1c1
Sequence:CCGGGCTGCACTATTATAGCCACGACTCGAGTCGTGGCTATAATAGTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172443.1-2398s1c1
Sequence:CCGGCAAGCCTTCAAGAGAAGGCAACTCGAGTTGCCTTCTCTTGAAGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172443.1-1997s1c1
Sequence:CCGGCTCTGCTTCAAGCGAGAGTTTCTCGAGAAACTCTCGCTTGAAGCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172443.1-256s1c1
Sequence:CCGGCCTGGATGGAAAGGTCATCTACTCGAGTAGATGACCTTTCCATCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172443.1-1597s1c1
Sequence:CCGGCTTCTGGCGTAATGTGCAGTTCTCGAGAACTGCACATTACGCCAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks