EMAIL THIS PAGE TO A FRIEND

TBC1D17

TBC1 domain family, member 17

UniProtKB ID: Q9HA65, B4DT12, F5H1W7
Gene ID:
Mouse(233204) TBC1 domain family, member 17
Rat(292886) TBC1 domain family, member 17
naked mole-rat(101711290) TBC1 domain family, member 17
domestic guinea pig(100721868) TBC1 domain family, member 17
cow(514858) TBC1 domain family, member 17
sheep(101109381) TBC1 domain family, member 17
Zebrafish(554092) TBC1 domain family, member 17
domestic cat(101093410) TBC1 domain family, member 17
Horse(100056274) TBC1 domain family, member 17
dog(484372) TBC1 domain family, member 17
97 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144924 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144924 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144924 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024682 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024682 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024682 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001042655 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001042655 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001042655 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024682 Rosetta Predictions human pricing
NM_001106258 Rosetta Predictions rat pricing
NM_001042655 Rosetta Predictions mouse pricing
NM_144924 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024682 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00223983 predicted 1209
2 SASI_Hs01_00223984 predicted 1357
3 SASI_Hs01_00223985 predicted 1108
4 SASI_Hs01_00223986 predicted 1448
5 SASI_Hs01_00223987 predicted 1445
6 SASI_Hs01_00223989 predicted 824
7 SASI_Hs01_00223990 predicted 1577
8 SASI_Hs01_00223991 predicted 1182
9 SASI_Hs01_00223992 predicted 396
10 SASI_Hs02_00357114 predicted 1284
11 SASI_Hs01_00223988 predicted 1370
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106258 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00217198 predicted 253
2 SASI_Rn02_00217199 predicted 1446
3 SASI_Rn02_00217200 predicted 1320
4 SASI_Rn02_00217201 predicted 1301
5 SASI_Rn02_00217202 predicted 265
6 SASI_Rn02_00217203 predicted 1171
7 SASI_Rn02_00217204 predicted 1166
8 SASI_Rn02_00217205 predicted 1232
9 SASI_Rn02_00217206 predicted 1695
10 SASI_Rn02_00217207 predicted 1449
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042655 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00290865 predicted 1329
2 SASI_Mm02_00290866 predicted 1090
3 SASI_Mm02_00290867 predicted 1488
4 SASI_Mm02_00290868 predicted 1505
5 SASI_Mm02_00290869 predicted 452
6 SASI_Mm02_00290870 predicted 1357
7 SASI_Mm02_00290871 predicted 1451
8 SASI_Mm02_00290872 predicted 1249
9 SASI_Mm02_00290873 predicted 437
10 SASI_Mm02_00290874 predicted 825
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144924 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00128987 predicted 1332
2 SASI_Mm01_00128988 predicted 1094
3 SASI_Mm01_00128989 predicted 1498
4 SASI_Mm01_00128990 predicted 1515
5 SASI_Mm01_00128991 predicted 462
6 SASI_Mm01_00128992 predicted 1356
7 SASI_Mm01_00128993 predicted 1453
8 SASI_Mm01_00128994 predicted 1254
9 SASI_Mm01_00128995 predicted 440
10 SASI_Mm01_00128996 predicted 837
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144924
TBC1D17 MISSION shRNA Bacterial Glycerol Stock
TBC1 domain family, member 17
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000200911    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144924.1-986s1c1
Sequence:CCGGCTGGCTTTGAGGTCATTTCTTCTCGAGAAGAAATGACCTCAAAGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192922    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144924.1-1886s1c1
Sequence:CCGGGCACATCAATGAACTGACCATCTCGAGATGGTCAGTTCATTGATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191923    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144924.1-1875s1c1
Sequence:CCGGGAGATCCTTAAGCACATCAATCTCGAGATTGATGTGCTTAAGGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144924
TBC1D17 MISSION shRNA shRNA Plasmid DNA
TBC1 domain family, member 17
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000200911    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144924.1-986s1c1
Sequence:CCGGCTGGCTTTGAGGTCATTTCTTCTCGAGAAGAAATGACCTCAAAGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192922    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144924.1-1886s1c1
Sequence:CCGGGCACATCAATGAACTGACCATCTCGAGATGGTCAGTTCATTGATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191923    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144924.1-1875s1c1
Sequence:CCGGGAGATCCTTAAGCACATCAATCTCGAGATTGATGTGCTTAAGGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144924
TBC1D17 MISSION shRNA Lentiviral Transduction Particles
TBC1 domain family, member 17
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000200911    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144924.1-986s1c1
Sequence:CCGGCTGGCTTTGAGGTCATTTCTTCTCGAGAAGAAATGACCTCAAAGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192922    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144924.1-1886s1c1
Sequence:CCGGGCACATCAATGAACTGACCATCTCGAGATGGTCAGTTCATTGATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191923    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144924.1-1875s1c1
Sequence:CCGGGAGATCCTTAAGCACATCAATCTCGAGATTGATGTGCTTAAGGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024682
VALIDATED
TBC1D17 MISSION shRNA Bacterial Glycerol Stock
TBC1 domain family, member 17
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000131068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024682.1-1295s1c1
Sequence:CCGGCACTGACAGGACCAACAAGTTCTCGAGAACTTGTTGGTCCTGTCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024682.1-1430s1c1
Sequence:CCGGGATCCTCTACGTCATTCAGAACTCGAGTTCTGAATGACGTAGAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024682.1-1817s1c1
Sequence:CCGGCAACGAGCTGACTATGAAGCTCTCGAGAGCTTCATAGTCAGCTCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127542    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024682.1-1796s1c1
Sequence:CCGGCAATGAGATCCTCAAGCACATCTCGAGATGTGCTTGAGGATCTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024682.1-213s1c1
Sequence:CCGGGCTAAGAAGTATCAGGACCGACTCGAGTCGGTCCTGATACTTCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_024682.1-1352s1c1
Sequence:CCGGGAACGATATCCTCCTCACCTACTCGAGTAGGTGAGGAGGATATCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024682
VALIDATED
TBC1D17 MISSION shRNA shRNA Plasmid DNA
TBC1 domain family, member 17
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000131068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024682.1-1295s1c1
Sequence:CCGGCACTGACAGGACCAACAAGTTCTCGAGAACTTGTTGGTCCTGTCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024682.1-1430s1c1
Sequence:CCGGGATCCTCTACGTCATTCAGAACTCGAGTTCTGAATGACGTAGAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024682.1-1817s1c1
Sequence:CCGGCAACGAGCTGACTATGAAGCTCTCGAGAGCTTCATAGTCAGCTCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127542    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024682.1-1796s1c1
Sequence:CCGGCAATGAGATCCTCAAGCACATCTCGAGATGTGCTTGAGGATCTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024682.1-213s1c1
Sequence:CCGGGCTAAGAAGTATCAGGACCGACTCGAGTCGGTCCTGATACTTCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_024682.1-1352s1c1
Sequence:CCGGGAACGATATCCTCCTCACCTACTCGAGTAGGTGAGGAGGATATCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024682
VALIDATED
TBC1D17 MISSION shRNA Lentiviral Transduction Particles
TBC1 domain family, member 17
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000131068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024682.1-1295s1c1
Sequence:CCGGCACTGACAGGACCAACAAGTTCTCGAGAACTTGTTGGTCCTGTCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024682.1-1430s1c1
Sequence:CCGGGATCCTCTACGTCATTCAGAACTCGAGTTCTGAATGACGTAGAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024682.1-1817s1c1
Sequence:CCGGCAACGAGCTGACTATGAAGCTCTCGAGAGCTTCATAGTCAGCTCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127542    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024682.1-1796s1c1
Sequence:CCGGCAATGAGATCCTCAAGCACATCTCGAGATGTGCTTGAGGATCTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024682.1-213s1c1
Sequence:CCGGGCTAAGAAGTATCAGGACCGACTCGAGTCGGTCCTGATACTTCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_024682.1-1352s1c1
Sequence:CCGGGAACGATATCCTCCTCACCTACTCGAGTAGGTGAGGAGGATATCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001042655
VALIDATED
TBC1D17 MISSION shRNA Bacterial Glycerol Stock
TBC1 domain family, member 17
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000248931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001042655.1-1240s21c1
Sequence:CCGGACGGATGAGTACTTCCGAATGCTCGAGCATTCGGAAGTACTCATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248933    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001042655.1-2311s21c1
Sequence:CCGGCTGCCATTGTGAGGCAATAAACTCGAGTTTATTGCCTCACAATGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001042655.1-465s21c1
Sequence:CCGGACCTGACTGGGCTGTCATTAGCTCGAGCTAATGACAGCCCAGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001042655.1-1398s21c1
Sequence:CCGGGCTGAGCCTGCTCCATGATATCTCGAGATATCATGGAGCAGGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001042655
VALIDATED
TBC1D17 MISSION shRNA shRNA Plasmid DNA
TBC1 domain family, member 17
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000248931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001042655.1-1240s21c1
Sequence:CCGGACGGATGAGTACTTCCGAATGCTCGAGCATTCGGAAGTACTCATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248933    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001042655.1-2311s21c1
Sequence:CCGGCTGCCATTGTGAGGCAATAAACTCGAGTTTATTGCCTCACAATGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001042655.1-465s21c1
Sequence:CCGGACCTGACTGGGCTGTCATTAGCTCGAGCTAATGACAGCCCAGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001042655.1-1398s21c1
Sequence:CCGGGCTGAGCCTGCTCCATGATATCTCGAGATATCATGGAGCAGGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001042655
VALIDATED
TBC1D17 MISSION shRNA Lentiviral Transduction Particles
TBC1 domain family, member 17
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000248931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001042655.1-1240s21c1
Sequence:CCGGACGGATGAGTACTTCCGAATGCTCGAGCATTCGGAAGTACTCATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248933    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001042655.1-2311s21c1
Sequence:CCGGCTGCCATTGTGAGGCAATAAACTCGAGTTTATTGCCTCACAATGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001042655.1-465s21c1
Sequence:CCGGACCTGACTGGGCTGTCATTAGCTCGAGCTAATGACAGCCCAGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001042655.1-1398s21c1
Sequence:CCGGGCTGAGCCTGCTCCATGATATCTCGAGATATCATGGAGCAGGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks