EMAIL THIS PAGE TO A FRIEND

TBC1D19

TBC1 domain family, member 19

UniProtKB ID: Q8N5T2, Q9NUX1
Gene ID:
Mouse(67249) TBC1 domain family, member 19
Rat(289657) TBC1 domain family, member 19
Zebrafish(393463) TBC1 domain family, member 19
domestic cat(101099713) TBC1 domain family, member 19
dog(479121) TBC1 domain family, member 19
chicken(422800) TBC1 domain family, member 19
cow(615452) TBC1 domain family, member 19
sheep(101108310) TBC1 domain family, member 19
domestic guinea pig(100716250) TBC1 domain family, member 19
naked mole-rat(101724415) TBC1 domain family, member 19
74 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018317 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018317 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018317 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_144517 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144517 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144517 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018317 Rosetta Predictions human pricing
NM_001106008 Rosetta Predictions rat pricing
NM_144517 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018317 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00351740 predicted 1422
2 SASI_Hs02_00351741 predicted 1516
3 SASI_Hs01_00216344 predicted 1036
4 SASI_Hs02_00351742 predicted 1001
5 SASI_Hs01_00216345 predicted 714
6 SASI_Hs01_00216346 predicted 1163
7 SASI_Hs01_00216347 predicted 894
8 SASI_Hs01_00216348 predicted 1104
9 SASI_Hs01_00216350 predicted 1584
10 SASI_Hs01_00216351 predicted 533
11 SASI_Hs01_00216349 predicted 514
12 SASI_Hs01_00216352 predicted 746
13 SASI_Hs01_00216353 predicted 708
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106008 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00214722 predicted 971
2 SASI_Rn02_00214723 predicted 691
3 SASI_Rn02_00214724 predicted 526
4 SASI_Rn02_00214725 predicted 755
5 SASI_Rn02_00214726 predicted 1225
6 SASI_Rn02_00214727 predicted 483
7 SASI_Rn02_00214728 predicted 451
8 SASI_Rn02_00214729 predicted 625
9 SASI_Rn02_00214730 predicted 1388
10 SASI_Rn02_00214731 predicted 1235
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144517 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00070092 predicted 212
2 SASI_Mm01_00070093 predicted 1717
3 SASI_Mm01_00070095 predicted 1304
4 SASI_Mm01_00070096 predicted 1181
5 SASI_Mm01_00070097 predicted 535
6 SASI_Mm01_00070098 predicted 759
7 SASI_Mm01_00070099 predicted 522
8 SASI_Mm01_00070100 predicted 471
9 SASI_Mm01_00070101 predicted 483
10 SASI_Mm02_00340034 predicted 1208
11 SASI_Mm01_00070094 predicted 1742
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018317
TBC1D19 MISSION shRNA Bacterial Glycerol Stock
TBC1 domain family, member 19
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018317.2-759s21c1
Sequence:CCGGTAATCTTCGCAACCCAAATTACTCGAGTAATTTGGGTTGCGAAGATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018317.2-890s21c1
Sequence:CCGGATATAGGACAACTGGGTATAGCTCGAGCTATACCCAGTTGTCCTATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018317.2-1585s21c1
Sequence:CCGGCAACCACTTCGCATATCATTTCTCGAGAAATGATATGCGAAGTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018317.2-1140s21c1
Sequence:CCGGGGTGGACAGTCTAATCTATAACTCGAGTTATAGATTAGACTGTCCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000131050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018317.1-212s1c1
Sequence:CCGGCAGTCTTCAGAGACCTGAGATCTCGAGATCTCAGGTCTCTGAAGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018317.1-840s1c1
Sequence:CCGGGCTCAACAGTACATCAGACAACTCGAGTTGTCTGATGTACTGTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018317.1-1458s1c1
Sequence:CCGGCGAGCTTTCTCTGGATACTTACTCGAGTAAGTATCCAGAGAAAGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018317.1-944s1c1
Sequence:CCGGGCAGCTTAAGACCAATGTGATCTCGAGATCACATTGGTCTTAAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128876    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018317.1-1745s1c1
Sequence:CCGGGAACTATGCAAACTCTGCATACTCGAGTATGCAGAGTTTGCATAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018317
TBC1D19 MISSION shRNA shRNA Plasmid DNA
TBC1 domain family, member 19
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018317.2-759s21c1
Sequence:CCGGTAATCTTCGCAACCCAAATTACTCGAGTAATTTGGGTTGCGAAGATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018317.2-890s21c1
Sequence:CCGGATATAGGACAACTGGGTATAGCTCGAGCTATACCCAGTTGTCCTATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018317.2-1585s21c1
Sequence:CCGGCAACCACTTCGCATATCATTTCTCGAGAAATGATATGCGAAGTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018317.2-1140s21c1
Sequence:CCGGGGTGGACAGTCTAATCTATAACTCGAGTTATAGATTAGACTGTCCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000131050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018317.1-212s1c1
Sequence:CCGGCAGTCTTCAGAGACCTGAGATCTCGAGATCTCAGGTCTCTGAAGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018317.1-840s1c1
Sequence:CCGGGCTCAACAGTACATCAGACAACTCGAGTTGTCTGATGTACTGTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018317.1-1458s1c1
Sequence:CCGGCGAGCTTTCTCTGGATACTTACTCGAGTAAGTATCCAGAGAAAGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018317.1-944s1c1
Sequence:CCGGGCAGCTTAAGACCAATGTGATCTCGAGATCACATTGGTCTTAAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128876    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018317.1-1745s1c1
Sequence:CCGGGAACTATGCAAACTCTGCATACTCGAGTATGCAGAGTTTGCATAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018317
TBC1D19 MISSION shRNA Lentiviral Transduction Particles
TBC1 domain family, member 19
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018317.2-759s21c1
Sequence:CCGGTAATCTTCGCAACCCAAATTACTCGAGTAATTTGGGTTGCGAAGATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018317.2-890s21c1
Sequence:CCGGATATAGGACAACTGGGTATAGCTCGAGCTATACCCAGTTGTCCTATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018317.2-1585s21c1
Sequence:CCGGCAACCACTTCGCATATCATTTCTCGAGAAATGATATGCGAAGTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018317.2-1140s21c1
Sequence:CCGGGGTGGACAGTCTAATCTATAACTCGAGTTATAGATTAGACTGTCCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000131050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018317.1-212s1c1
Sequence:CCGGCAGTCTTCAGAGACCTGAGATCTCGAGATCTCAGGTCTCTGAAGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018317.1-840s1c1
Sequence:CCGGGCTCAACAGTACATCAGACAACTCGAGTTGTCTGATGTACTGTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018317.1-1458s1c1
Sequence:CCGGCGAGCTTTCTCTGGATACTTACTCGAGTAAGTATCCAGAGAAAGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018317.1-944s1c1
Sequence:CCGGGCAGCTTAAGACCAATGTGATCTCGAGATCACATTGGTCTTAAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128876    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018317.1-1745s1c1
Sequence:CCGGGAACTATGCAAACTCTGCATACTCGAGTATGCAGAGTTTGCATAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144517
VALIDATED
TBC1D19 MISSION shRNA Bacterial Glycerol Stock
TBC1 domain family, member 19
Mouse
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000345579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144517.4-944s21c1
Sequence:CCGGCCTGAGGATATCCTGTATTATCTCGAGATAATACAGGATATCCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144517.4-552s21c1
Sequence:CCGGGAACGGATGAGCCAGATTTAACTCGAGTTAAATCTGGCTCATCCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345515    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144517.4-1823s21c1
Sequence:CCGGCATGTTCCCTCCTCCGTTAAACTCGAGTTTAACGGAGGAGGGAACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144517.4-1448s21c1
Sequence:CCGGCAACCACTTCGGATATCATTTCTCGAGAAATGATATCCGAAGTGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144517.4-1502s21c1
Sequence:CCGGGCTACAGATCAACTCTTGCTTCTCGAGAAGCAAGAGTTGATCTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194026    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144517.2-463s1c1
Sequence:CCGGGAGCAGAAAGAGCTTCTCAATCTCGAGATTGAGAAGCTCTTTCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193212    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144517.2-664s1c1
Sequence:CCGGCCTGAATTGAAAGAATGCTTTCTCGAGAAAGCATTCTTTCAATTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193086    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144517.2-210s1c2
Sequence:CCGGCGAATCACTCAAAGAAGATATCTCGAGATATCTTCTTTGAGTGATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_144517.2-1450s1c1
Sequence:CCGGGCTACAGATCAACTCTTGCTTCTCGAGAAGCAAGAGTTGATCTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144517.2-1104s1c1
Sequence:CCGGGAAGTCATACATCAGAGGAAACTCGAGTTTCCTCTGATGTATGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_144517.2-988s1c1
Sequence:CCGGGCAAGCAATGATGATTACTATCTCGAGATAGTAATCATCATTGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174762    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144517.2-472s1c1
Sequence:CCGGGAGCTTCTCAATAAGTGGAATCTCGAGATTCCACTTATTGAGAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174301    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144517.2-663s1c1
Sequence:CCGGCCCTGAATTGAAAGAATGCTTCTCGAGAAGCATTCTTTCAATTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_144517.2-892s1c1
Sequence:CCGGCCTGAGGATATCCTGTATTATCTCGAGATAATACAGGATATCCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174494    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_144517.2-1736s1c1
Sequence:CCGGCCAGAATTAAACTTTGCACATCTCGAGATGTGCAAAGTTTAATTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144517
VALIDATED
TBC1D19 MISSION shRNA shRNA Plasmid DNA
TBC1 domain family, member 19
Mouse
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000345579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144517.4-944s21c1
Sequence:CCGGCCTGAGGATATCCTGTATTATCTCGAGATAATACAGGATATCCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144517.4-552s21c1
Sequence:CCGGGAACGGATGAGCCAGATTTAACTCGAGTTAAATCTGGCTCATCCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345515    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144517.4-1823s21c1
Sequence:CCGGCATGTTCCCTCCTCCGTTAAACTCGAGTTTAACGGAGGAGGGAACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144517.4-1448s21c1
Sequence:CCGGCAACCACTTCGGATATCATTTCTCGAGAAATGATATCCGAAGTGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144517.4-1502s21c1
Sequence:CCGGGCTACAGATCAACTCTTGCTTCTCGAGAAGCAAGAGTTGATCTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194026    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144517.2-463s1c1
Sequence:CCGGGAGCAGAAAGAGCTTCTCAATCTCGAGATTGAGAAGCTCTTTCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193212    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144517.2-664s1c1
Sequence:CCGGCCTGAATTGAAAGAATGCTTTCTCGAGAAAGCATTCTTTCAATTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193086    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144517.2-210s1c2
Sequence:CCGGCGAATCACTCAAAGAAGATATCTCGAGATATCTTCTTTGAGTGATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_144517.2-1450s1c1
Sequence:CCGGGCTACAGATCAACTCTTGCTTCTCGAGAAGCAAGAGTTGATCTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144517.2-1104s1c1
Sequence:CCGGGAAGTCATACATCAGAGGAAACTCGAGTTTCCTCTGATGTATGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_144517.2-988s1c1
Sequence:CCGGGCAAGCAATGATGATTACTATCTCGAGATAGTAATCATCATTGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174762    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144517.2-472s1c1
Sequence:CCGGGAGCTTCTCAATAAGTGGAATCTCGAGATTCCACTTATTGAGAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174301    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144517.2-663s1c1
Sequence:CCGGCCCTGAATTGAAAGAATGCTTCTCGAGAAGCATTCTTTCAATTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_144517.2-892s1c1
Sequence:CCGGCCTGAGGATATCCTGTATTATCTCGAGATAATACAGGATATCCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174494    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_144517.2-1736s1c1
Sequence:CCGGCCAGAATTAAACTTTGCACATCTCGAGATGTGCAAAGTTTAATTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144517
VALIDATED
TBC1D19 MISSION shRNA Lentiviral Transduction Particles
TBC1 domain family, member 19
Mouse
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000345579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144517.4-944s21c1
Sequence:CCGGCCTGAGGATATCCTGTATTATCTCGAGATAATACAGGATATCCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144517.4-552s21c1
Sequence:CCGGGAACGGATGAGCCAGATTTAACTCGAGTTAAATCTGGCTCATCCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345515    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144517.4-1823s21c1
Sequence:CCGGCATGTTCCCTCCTCCGTTAAACTCGAGTTTAACGGAGGAGGGAACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144517.4-1448s21c1
Sequence:CCGGCAACCACTTCGGATATCATTTCTCGAGAAATGATATCCGAAGTGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144517.4-1502s21c1
Sequence:CCGGGCTACAGATCAACTCTTGCTTCTCGAGAAGCAAGAGTTGATCTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194026    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144517.2-463s1c1
Sequence:CCGGGAGCAGAAAGAGCTTCTCAATCTCGAGATTGAGAAGCTCTTTCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193212    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144517.2-664s1c1
Sequence:CCGGCCTGAATTGAAAGAATGCTTTCTCGAGAAAGCATTCTTTCAATTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193086    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144517.2-210s1c2
Sequence:CCGGCGAATCACTCAAAGAAGATATCTCGAGATATCTTCTTTGAGTGATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_144517.2-1450s1c1
Sequence:CCGGGCTACAGATCAACTCTTGCTTCTCGAGAAGCAAGAGTTGATCTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144517.2-1104s1c1
Sequence:CCGGGAAGTCATACATCAGAGGAAACTCGAGTTTCCTCTGATGTATGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_144517.2-988s1c1
Sequence:CCGGGCAAGCAATGATGATTACTATCTCGAGATAGTAATCATCATTGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174762    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144517.2-472s1c1
Sequence:CCGGGAGCTTCTCAATAAGTGGAATCTCGAGATTCCACTTATTGAGAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174301    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144517.2-663s1c1
Sequence:CCGGCCCTGAATTGAAAGAATGCTTCTCGAGAAGCATTCTTTCAATTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_144517.2-892s1c1
Sequence:CCGGCCTGAGGATATCCTGTATTATCTCGAGATAATACAGGATATCCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174494    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_144517.2-1736s1c1
Sequence:CCGGCCAGAATTAAACTTTGCACATCTCGAGATGTGCAAAGTTTAATTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks