EMAIL THIS PAGE TO A FRIEND

TBC1D1

TBC1 (tre-2/USP6, BUB2, cdc16) domain family, member 1

Synonyms: TBC TBC1
UniProtKB ID: Q86TI0, B7Z3D9, E9PGH8, Q96K82, Q9UPP4
Gene ID:
Human(23216) Summary: TBC1D1 is the founding member of a family of proteins sharing a 180- to 200-amino acid TBC domain presumed to have a role in regulating cell growth and differentiation. These proteins share significant homology with TRE2 (USP6; MIM 604334), yeast Bub2, and CDC16 (MIM 603461) (White et al., 2000 [PubMed 10965142]
Mouse(57915) TBC1 domain family, member 1
Rat(360937) TBC1 (tre-2/USP6, BUB2, cdc16) domain family, member 1
Zebrafish(561193) TBC1 (tre-2/USP6, BUB2, cdc16) domain family, member 1
domestic cat(101086057) TBC1 (tre-2/USP6, BUB2, cdc16) domain family, member 1
Horse(100055336) TBC1 (tre-2/USP6, BUB2, cdc16) domain family, member 1
dog(479115) TBC1 (tre-2/USP6, BUB2, cdc16) domain family, member 1
chicken(426162) TBC1 (tre-2/USP6, BUB2, cdc16) domain family, member 1
cow(282704) TBC1 (tre-2/USP6, BUB2, cdc16) domain family, member 1
sheep(101111550) TBC1 (tre-2/USP6, BUB2, cdc16) domain family, member 1
domestic guinea pig(100713383) TBC1 (tre-2/USP6, BUB2, cdc16) domain family, member 1
naked mole-rat(101713688) TBC1 (tre-2/USP6, BUB2, cdc16) domain family, member 1
Domestic Rabbit(100352741) TBC1 (tre-2/USP6, BUB2, cdc16) domain family, member 1
114 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015173 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015173 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015173 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019636 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019636 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019636 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU137731 MISSION® esiRNA esiRNA human TBC1D1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015173 Rosetta Predictions human pricing
XM_001071842 Rosetta Predictions rat pricing
XM_341215 Rosetta Predictions rat pricing
NM_019636 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015173 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00048390 predicted 1600
2 SASI_Hs01_00048391 predicted 1921
3 SASI_Hs02_00347177 predicted 1142
4 SASI_Hs01_00048393 predicted 2518
5 SASI_Hs01_00048394 predicted 3109
6 SASI_Hs02_00347178 predicted 1965
7 SASI_Hs01_00048395 predicted 1802
8 SASI_Hs01_00048397 predicted 1205
9 SASI_Hs02_00347179 predicted 3324
10 SASI_Hs01_00048398 predicted 596
11 SASI_Hs01_00048392 predicted 2388
12 SASI_Hs01_00048396 predicted 679
13 SASI_Hs01_00048399 predicted 1661
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071842 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00336656 predicted 4657
2 SASI_Rn02_00336657 predicted 1977
3 SASI_Rn02_00336658 predicted 4430
4 SASI_Rn02_00336659 predicted 2618
5 SASI_Rn02_00336660 predicted 3199
6 SASI_Rn02_00336661 predicted 4956
7 SASI_Rn02_00336662 predicted 4941
8 SASI_Rn02_00336663 predicted 4422
9 SASI_Rn02_00336664 predicted 4173
10 SASI_Rn02_00336665 predicted 1928
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341215 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00392593 predicted 4656
2 SASI_Rn02_00392594 predicted 1974
3 SASI_Rn02_00392595 predicted 4437
4 SASI_Rn02_00392596 predicted 2619
5 SASI_Rn02_00392597 predicted 3197
6 SASI_Rn02_00392598 predicted 4950
7 SASI_Rn02_00392599 predicted 4942
8 SASI_Rn02_00392600 predicted 4422
9 SASI_Rn02_00392601 predicted 4176
10 SASI_Rn02_00392602 predicted 1928
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019636 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00179195 predicted 1224
2 SASI_Mm01_00179196 predicted 986
3 SASI_Mm01_00179197 predicted 2057
4 SASI_Mm01_00179198 predicted 1864
5 SASI_Mm01_00179199 predicted 721
6 SASI_Mm01_00179200 predicted 3133
7 SASI_Mm02_00324673 predicted 3862
8 SASI_Mm01_00179201 predicted 838
9 SASI_Mm01_00179202 predicted 3714
10 SASI_Mm01_00179203 predicted 1332
11 SASI_Mm01_00179204 predicted 1590
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015173
VALIDATED
TBC1D1 MISSION shRNA Bacterial Glycerol Stock
TBC1 (tre-2/USP6, BUB2, cdc16) domain family, member 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015173.2-2198s21c1
Sequence:CCGGCAAAGGAAACTTATGAGGTATCTCGAGATACCTCATAAGTTTCCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015173.2-2424s21c1
Sequence:CCGGGATCTCCTTTAGAACCAGTTTCTCGAGAAACTGGTTCTAAAGGAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015173.2-3397s21c1
Sequence:CCGGCCTAGAAACCATAGTTGACTTCTCGAGAAGTCAACTATGGTTTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015173.2-3567s21c1
Sequence:CCGGGTGACAACCAAAGAATGGATACTCGAGTATCCATTCTTTGGTTGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015173.1-1781s1c1
Sequence:CCGGGTGACAACCAAAGAATGGATACTCGAGTATCCATTCTTTGGTTGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015173.1-1611s1c1
Sequence:CCGGCCTAGAAACCATAGTTGACTTCTCGAGAAGTCAACTATGGTTTCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015173.1-638s1c1
Sequence:CCGGGATCTCCTTTAGAACCAGTTTCTCGAGAAACTGGTTCTAAAGGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015173.1-412s1c1
Sequence:CCGGCAAAGGAAACTTATGAGGTATCTCGAGATACCTCATAAGTTTCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015173.1-1707s1c1
Sequence:CCGGCGCTAAACAGTTACAAGCTTACTCGAGTAAGCTTGTAACTGTTTAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015173
VALIDATED
TBC1D1 MISSION shRNA shRNA Plasmid DNA
TBC1 (tre-2/USP6, BUB2, cdc16) domain family, member 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015173.2-2198s21c1
Sequence:CCGGCAAAGGAAACTTATGAGGTATCTCGAGATACCTCATAAGTTTCCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015173.2-2424s21c1
Sequence:CCGGGATCTCCTTTAGAACCAGTTTCTCGAGAAACTGGTTCTAAAGGAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015173.2-3397s21c1
Sequence:CCGGCCTAGAAACCATAGTTGACTTCTCGAGAAGTCAACTATGGTTTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015173.2-3567s21c1
Sequence:CCGGGTGACAACCAAAGAATGGATACTCGAGTATCCATTCTTTGGTTGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015173.1-1781s1c1
Sequence:CCGGGTGACAACCAAAGAATGGATACTCGAGTATCCATTCTTTGGTTGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015173.1-1611s1c1
Sequence:CCGGCCTAGAAACCATAGTTGACTTCTCGAGAAGTCAACTATGGTTTCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015173.1-638s1c1
Sequence:CCGGGATCTCCTTTAGAACCAGTTTCTCGAGAAACTGGTTCTAAAGGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015173.1-412s1c1
Sequence:CCGGCAAAGGAAACTTATGAGGTATCTCGAGATACCTCATAAGTTTCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015173.1-1707s1c1
Sequence:CCGGCGCTAAACAGTTACAAGCTTACTCGAGTAAGCTTGTAACTGTTTAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015173
VALIDATED
TBC1D1 MISSION shRNA Lentiviral Transduction Particles
TBC1 (tre-2/USP6, BUB2, cdc16) domain family, member 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015173.2-2198s21c1
Sequence:CCGGCAAAGGAAACTTATGAGGTATCTCGAGATACCTCATAAGTTTCCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015173.2-2424s21c1
Sequence:CCGGGATCTCCTTTAGAACCAGTTTCTCGAGAAACTGGTTCTAAAGGAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015173.2-3397s21c1
Sequence:CCGGCCTAGAAACCATAGTTGACTTCTCGAGAAGTCAACTATGGTTTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015173.2-3567s21c1
Sequence:CCGGGTGACAACCAAAGAATGGATACTCGAGTATCCATTCTTTGGTTGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015173.1-1781s1c1
Sequence:CCGGGTGACAACCAAAGAATGGATACTCGAGTATCCATTCTTTGGTTGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015173.1-1611s1c1
Sequence:CCGGCCTAGAAACCATAGTTGACTTCTCGAGAAGTCAACTATGGTTTCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015173.1-638s1c1
Sequence:CCGGGATCTCCTTTAGAACCAGTTTCTCGAGAAACTGGTTCTAAAGGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015173.1-412s1c1
Sequence:CCGGCAAAGGAAACTTATGAGGTATCTCGAGATACCTCATAAGTTTCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015173.1-1707s1c1
Sequence:CCGGCGCTAAACAGTTACAAGCTTACTCGAGTAAGCTTGTAACTGTTTAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019636
VALIDATED
TBC1D1 MISSION shRNA Bacterial Glycerol Stock
TBC1 (tre-2/USP6, BUB2, cdc16) domain family, member 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000304917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019636.2-3347s21c1
Sequence:CCGGCAGGGATCAGAGGTCATATTTCTCGAGAAATATGACCTCTGATCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304916    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019636.2-3887s21c1
Sequence:CCGGGAAGAGACTGTGCACCATTAACTCGAGTTAATGGTGCACAGTCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019636.2-3146s21c1
Sequence:CCGGTATCGGCCAGACATGATTATTCTCGAGAATAATCATGTCTGGCCGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019636.2-2664s21c1
Sequence:CCGGCGTGTCTTAAAGAAGTCACTACTCGAGTAGTGACTTCTTTAAGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019636.2-3707s21c1
Sequence:CCGGGCCACGGTAGAGAAACTTCTTCTCGAGAAGAAGTTTCTCTACCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019636.1-2311s1c1
Sequence:CCGGCCGAGCAGATATGAAGATTATCTCGAGATAATCTTCATATCTGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019636.1-2570s1c1
Sequence:CCGGCGTGTCTTAAAGAAGTCACTACTCGAGTAGTGACTTCTTTAAGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019636.1-3613s1c1
Sequence:CCGGGCCACGGTAGAGAAACTTCTTCTCGAGAAGAAGTTTCTCTACCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019636.1-864s1c1
Sequence:CCGGCGCACTGATTGACGAGTGTATCTCGAGATACACTCGTCAATCAGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111170    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019636.1-3848s1c1
Sequence:CCGGGAGGCAGAGAAGAGAGAACTTCTCGAGAAGTTCTCTCTTCTCTGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019636
VALIDATED
TBC1D1 MISSION shRNA shRNA Plasmid DNA
TBC1 (tre-2/USP6, BUB2, cdc16) domain family, member 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000304917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019636.2-3347s21c1
Sequence:CCGGCAGGGATCAGAGGTCATATTTCTCGAGAAATATGACCTCTGATCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304916    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019636.2-3887s21c1
Sequence:CCGGGAAGAGACTGTGCACCATTAACTCGAGTTAATGGTGCACAGTCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019636.2-3146s21c1
Sequence:CCGGTATCGGCCAGACATGATTATTCTCGAGAATAATCATGTCTGGCCGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019636.2-2664s21c1
Sequence:CCGGCGTGTCTTAAAGAAGTCACTACTCGAGTAGTGACTTCTTTAAGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019636.2-3707s21c1
Sequence:CCGGGCCACGGTAGAGAAACTTCTTCTCGAGAAGAAGTTTCTCTACCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019636.1-2311s1c1
Sequence:CCGGCCGAGCAGATATGAAGATTATCTCGAGATAATCTTCATATCTGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019636.1-2570s1c1
Sequence:CCGGCGTGTCTTAAAGAAGTCACTACTCGAGTAGTGACTTCTTTAAGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019636.1-3613s1c1
Sequence:CCGGGCCACGGTAGAGAAACTTCTTCTCGAGAAGAAGTTTCTCTACCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019636.1-864s1c1
Sequence:CCGGCGCACTGATTGACGAGTGTATCTCGAGATACACTCGTCAATCAGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111170    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019636.1-3848s1c1
Sequence:CCGGGAGGCAGAGAAGAGAGAACTTCTCGAGAAGTTCTCTCTTCTCTGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019636
VALIDATED
TBC1D1 MISSION shRNA Lentiviral Transduction Particles
TBC1 (tre-2/USP6, BUB2, cdc16) domain family, member 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000304917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019636.2-3347s21c1
Sequence:CCGGCAGGGATCAGAGGTCATATTTCTCGAGAAATATGACCTCTGATCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304916    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019636.2-3887s21c1
Sequence:CCGGGAAGAGACTGTGCACCATTAACTCGAGTTAATGGTGCACAGTCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019636.2-3146s21c1
Sequence:CCGGTATCGGCCAGACATGATTATTCTCGAGAATAATCATGTCTGGCCGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019636.2-2664s21c1
Sequence:CCGGCGTGTCTTAAAGAAGTCACTACTCGAGTAGTGACTTCTTTAAGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019636.2-3707s21c1
Sequence:CCGGGCCACGGTAGAGAAACTTCTTCTCGAGAAGAAGTTTCTCTACCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019636.1-2311s1c1
Sequence:CCGGCCGAGCAGATATGAAGATTATCTCGAGATAATCTTCATATCTGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019636.1-2570s1c1
Sequence:CCGGCGTGTCTTAAAGAAGTCACTACTCGAGTAGTGACTTCTTTAAGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019636.1-3613s1c1
Sequence:CCGGGCCACGGTAGAGAAACTTCTTCTCGAGAAGAAGTTTCTCTACCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019636.1-864s1c1
Sequence:CCGGCGCACTGATTGACGAGTGTATCTCGAGATACACTCGTCAATCAGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111170    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019636.1-3848s1c1
Sequence:CCGGGAGGCAGAGAAGAGAGAACTTCTCGAGAAGTTCTCTCTTCTCTGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks