EMAIL THIS PAGE TO A FRIEND

TBC1D20

TBC1 domain family, member 20

Synonyms: C20orf140
Gene ID:
Mouse(67231) TBC1 domain family, member 20
Rat(362237) TBC1 domain family, member 20
Zebrafish(573993) TBC1 domain family, member 20
Horse(100067965) TBC1 domain family, member 20
domestic cat(101083925) TBC1 domain family, member 20
chicken(771781) TBC1 domain family, member 20
dog(485817) TBC1 domain family, member 20
cow(504543) TBC1 domain family, member 20
sheep(101108244) TBC1 domain family, member 20
domestic guinea pig(100736143) TBC1 domain family, member 20
naked mole-rat(101723896) TBC1 domain family, member 20
Domestic Rabbit(100357305) TBC1 domain family, member 20
85 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024196 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024196 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024196 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_144628 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144628 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144628 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144628 Rosetta Predictions human pricing
NM_001004281 Rosetta Predictions rat pricing
NM_024196 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144628 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00364455 predicted 1351
2 SASI_Hs02_00364456 predicted 621
3 SASI_Hs01_00066309 predicted 1144
4 SASI_Hs01_00066312 predicted 371
5 SASI_Hs01_00066314 predicted 1100
6 SASI_Hs02_00364457 predicted 1416
7 SASI_Hs01_00066316 predicted 698
8 SASI_Hs02_00364458 predicted 585
9 SASI_Hs02_00364459 predicted 575
10 SASI_Hs02_00364460 predicted 886
11 SASI_Hs01_00066307 predicted 978
12 SASI_Hs01_00066308 predicted 311
13 SASI_Hs01_00066310 predicted 1175
14 SASI_Hs01_00066311 predicted 608
15 SASI_Hs01_00066313 predicted 1188
16 SASI_Hs01_00066315 predicted 537
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004281 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00198325 predicted 788
2 SASI_Rn01_00102115 predicted 533
3 SASI_Rn01_00102116 predicted 1019
4 SASI_Rn01_00102118 predicted 454
5 SASI_Rn02_00198326 predicted 304
6 SASI_Rn02_00198327 predicted 797
7 SASI_Rn01_00102119 predicted 898
8 SASI_Rn01_00102120 predicted 939
9 SASI_Rn01_00102122 predicted 1062
10 SASI_Rn01_00102124 predicted 1029
11 SASI_Rn01_00102117 predicted 604
12 SASI_Rn01_00102121 predicted 610
13 SASI_Rn01_00102123 predicted 497
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024196 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00103284 predicted 575
2 SASI_Mm01_00103286 predicted 280
3 SASI_Mm01_00103287 predicted 835
4 SASI_Mm02_00327531 predicted 797
5 SASI_Mm01_00103288 predicted 303
6 SASI_Mm02_00327532 predicted 842
7 SASI_Mm01_00103289 predicted 1060
8 SASI_Mm01_00103290 predicted 1077
9 SASI_Mm01_00103291 predicted 1041
10 SASI_Mm01_00103292 predicted 535
11 SASI_Mm01_00103285 predicted 1392
12 SASI_Mm01_00103293 predicted 1111
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024196
TBC1D20 MISSION shRNA Bacterial Glycerol Stock
TBC1 domain family, member 20
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000354046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024196.3-537s21c1
Sequence:CCGGCCATGACATCGTGGTCACATTCTCGAGAATGTGACCACGATGTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024196.3-657s21c1
Sequence:CCGGGCACATCCTAAATTATCTGATCTCGAGATCAGATAATTTAGGATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024196.3-801s21c1
Sequence:CCGGCGTTGTGAGGTTATACGACTTCTCGAGAAGTCGTATAACCTCACAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024196.3-834s21c1
Sequence:CCGGCCACCCACTTATGCCCATTTACTCGAGTAAATGGGCATAAGTGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024196.1-835s1c1
Sequence:CCGGCCACCCACTTATGCCCATTTACTCGAGTAAATGGGCATAAGTGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024196.1-538s1c1
Sequence:CCGGCCATGACATCGTGGTCACATTCTCGAGAATGTGACCACGATGTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024196.1-802s1c1
Sequence:CCGGCGTTGTGAGGTTATACGACTTCTCGAGAAGTCGTATAACCTCACAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024196.1-658s1c1
Sequence:CCGGGCACATCCTAAATTATCTGATCTCGAGATCAGATAATTTAGGATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127099    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024196.1-1597s1c1
Sequence:CCGGCCATGTGTCTTGAGTATCTTTCTCGAGAAAGATACTCAAGACACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024196
TBC1D20 MISSION shRNA shRNA Plasmid DNA
TBC1 domain family, member 20
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000354046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024196.3-537s21c1
Sequence:CCGGCCATGACATCGTGGTCACATTCTCGAGAATGTGACCACGATGTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024196.3-657s21c1
Sequence:CCGGGCACATCCTAAATTATCTGATCTCGAGATCAGATAATTTAGGATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024196.3-801s21c1
Sequence:CCGGCGTTGTGAGGTTATACGACTTCTCGAGAAGTCGTATAACCTCACAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024196.3-834s21c1
Sequence:CCGGCCACCCACTTATGCCCATTTACTCGAGTAAATGGGCATAAGTGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024196.1-835s1c1
Sequence:CCGGCCACCCACTTATGCCCATTTACTCGAGTAAATGGGCATAAGTGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024196.1-538s1c1
Sequence:CCGGCCATGACATCGTGGTCACATTCTCGAGAATGTGACCACGATGTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024196.1-802s1c1
Sequence:CCGGCGTTGTGAGGTTATACGACTTCTCGAGAAGTCGTATAACCTCACAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024196.1-658s1c1
Sequence:CCGGGCACATCCTAAATTATCTGATCTCGAGATCAGATAATTTAGGATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127099    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024196.1-1597s1c1
Sequence:CCGGCCATGTGTCTTGAGTATCTTTCTCGAGAAAGATACTCAAGACACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024196
TBC1D20 MISSION shRNA Lentiviral Transduction Particles
TBC1 domain family, member 20
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000354046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024196.3-537s21c1
Sequence:CCGGCCATGACATCGTGGTCACATTCTCGAGAATGTGACCACGATGTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024196.3-657s21c1
Sequence:CCGGGCACATCCTAAATTATCTGATCTCGAGATCAGATAATTTAGGATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024196.3-801s21c1
Sequence:CCGGCGTTGTGAGGTTATACGACTTCTCGAGAAGTCGTATAACCTCACAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024196.3-834s21c1
Sequence:CCGGCCACCCACTTATGCCCATTTACTCGAGTAAATGGGCATAAGTGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024196.1-835s1c1
Sequence:CCGGCCACCCACTTATGCCCATTTACTCGAGTAAATGGGCATAAGTGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024196.1-538s1c1
Sequence:CCGGCCATGACATCGTGGTCACATTCTCGAGAATGTGACCACGATGTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024196.1-802s1c1
Sequence:CCGGCGTTGTGAGGTTATACGACTTCTCGAGAAGTCGTATAACCTCACAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024196.1-658s1c1
Sequence:CCGGGCACATCCTAAATTATCTGATCTCGAGATCAGATAATTTAGGATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127099    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024196.1-1597s1c1
Sequence:CCGGCCATGTGTCTTGAGTATCTTTCTCGAGAAAGATACTCAAGACACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144628
VALIDATED
TBC1D20 MISSION shRNA Bacterial Glycerol Stock
TBC1 domain family, member 20
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000297183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_144628.2-888s21c1
Sequence:CCGGGATTTACTTTGCAGCCGTGATCTCGAGATCACGGCTGCAAAGTAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278257    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_144628.2-1364s21c1
Sequence:CCGGCCTTCCTCTTACATCACATTACTCGAGTAATGTGATGTAAGAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_144628.2-843s21c1
Sequence:CCGGCGTGCGGTTATATGACTTCTTCTCGAGAAGAAGTCATATAACCGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_144628.2-680s21c1
Sequence:CCGGCAATGGACAACACCAAGCATACTCGAGTATGCTTGGTGTTGTCCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_144628.2-1235s21c1
Sequence:CCGGGCTTTGTGAAATTGGCAGTGACTCGAGTCACTGCCAATTTCACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_144628.1-1195s1c1
Sequence:CCGGGCTTTGTGAAATTGGCAGTGACTCGAGTCACTGCCAATTTCACAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_144628.1-848s1c1
Sequence:CCGGGATTTACTTTGCAGCCGTGATCTCGAGATCACGGCTGCAAAGTAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129790    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_144628.1-1324s1c1
Sequence:CCGGCCTTCCTCTTACATCACATTACTCGAGTAATGTGATGTAAGAGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148910    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144628.1-536s1c1
Sequence:CCGGCCATGACATTGTGGTCACATTCTCGAGAATGTGACCACAATGTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_144628.1-803s1c1
Sequence:CCGGCGTGCGGTTATATGACTTCTTCTCGAGAAGAAGTCATATAACCGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_144628.1-640s1c1
Sequence:CCGGCAATGGACAACACCAAGCATACTCGAGTATGCTTGGTGTTGTCCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144628
VALIDATED
TBC1D20 MISSION shRNA shRNA Plasmid DNA
TBC1 domain family, member 20
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000297183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_144628.2-888s21c1
Sequence:CCGGGATTTACTTTGCAGCCGTGATCTCGAGATCACGGCTGCAAAGTAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278257    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_144628.2-1364s21c1
Sequence:CCGGCCTTCCTCTTACATCACATTACTCGAGTAATGTGATGTAAGAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_144628.2-843s21c1
Sequence:CCGGCGTGCGGTTATATGACTTCTTCTCGAGAAGAAGTCATATAACCGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_144628.2-680s21c1
Sequence:CCGGCAATGGACAACACCAAGCATACTCGAGTATGCTTGGTGTTGTCCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_144628.2-1235s21c1
Sequence:CCGGGCTTTGTGAAATTGGCAGTGACTCGAGTCACTGCCAATTTCACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_144628.1-1195s1c1
Sequence:CCGGGCTTTGTGAAATTGGCAGTGACTCGAGTCACTGCCAATTTCACAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_144628.1-848s1c1
Sequence:CCGGGATTTACTTTGCAGCCGTGATCTCGAGATCACGGCTGCAAAGTAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129790    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_144628.1-1324s1c1
Sequence:CCGGCCTTCCTCTTACATCACATTACTCGAGTAATGTGATGTAAGAGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148910    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144628.1-536s1c1
Sequence:CCGGCCATGACATTGTGGTCACATTCTCGAGAATGTGACCACAATGTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_144628.1-803s1c1
Sequence:CCGGCGTGCGGTTATATGACTTCTTCTCGAGAAGAAGTCATATAACCGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_144628.1-640s1c1
Sequence:CCGGCAATGGACAACACCAAGCATACTCGAGTATGCTTGGTGTTGTCCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144628
VALIDATED
TBC1D20 MISSION shRNA Lentiviral Transduction Particles
TBC1 domain family, member 20
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000297183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_144628.2-888s21c1
Sequence:CCGGGATTTACTTTGCAGCCGTGATCTCGAGATCACGGCTGCAAAGTAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278257    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_144628.2-1364s21c1
Sequence:CCGGCCTTCCTCTTACATCACATTACTCGAGTAATGTGATGTAAGAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_144628.2-843s21c1
Sequence:CCGGCGTGCGGTTATATGACTTCTTCTCGAGAAGAAGTCATATAACCGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_144628.2-680s21c1
Sequence:CCGGCAATGGACAACACCAAGCATACTCGAGTATGCTTGGTGTTGTCCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_144628.2-1235s21c1
Sequence:CCGGGCTTTGTGAAATTGGCAGTGACTCGAGTCACTGCCAATTTCACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_144628.1-1195s1c1
Sequence:CCGGGCTTTGTGAAATTGGCAGTGACTCGAGTCACTGCCAATTTCACAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_144628.1-848s1c1
Sequence:CCGGGATTTACTTTGCAGCCGTGATCTCGAGATCACGGCTGCAAAGTAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129790    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_144628.1-1324s1c1
Sequence:CCGGCCTTCCTCTTACATCACATTACTCGAGTAATGTGATGTAAGAGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148910    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144628.1-536s1c1
Sequence:CCGGCCATGACATTGTGGTCACATTCTCGAGAATGTGACCACAATGTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_144628.1-803s1c1
Sequence:CCGGCGTGCGGTTATATGACTTCTTCTCGAGAAGAAGTCATATAACCGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_144628.1-640s1c1
Sequence:CCGGCAATGGACAACACCAAGCATACTCGAGTATGCTTGGTGTTGTCCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks