EMAIL THIS PAGE TO A FRIEND

TBC1D21

TBC1 domain family, member 21

Synonyms: MgcRabGAP
UniProtKB ID: Q8IYX1
Gene ID:
Mouse(74286) TBC1 domain family, member 21
Rat(363072) TBC1 domain family, member 21
naked mole-rat(101710976) TBC1 domain family, member 21
domestic guinea pig(100717606) TBC1 domain family, member 21
cow(506254) TBC1 domain family, member 21
sheep(101112061) TBC1 domain family, member 21
domestic cat(101087234) TBC1 domain family, member 21
Horse(100051924) TBC1 domain family, member 21
dog(611467) TBC1 domain family, member 21
79 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153356 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153356 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153356 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028854 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028854 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028854 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU044211 MISSION® esiRNA esiRNA human TBC1D21 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153356 Rosetta Predictions human pricing
NM_001014210 Rosetta Predictions rat pricing
XM_001074771 Rosetta Predictions rat pricing
NM_028854 Rosetta Predictions mouse pricing
XM_134945 Rosetta Predictions mouse pricing
XM_897464 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153356 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00010711 predicted 656
2 SASI_Hs01_00010712 predicted 619
3 SASI_Hs01_00010713 predicted 696
4 SASI_Hs01_00010714 predicted 428
5 SASI_Hs01_00010715 predicted 815
6 SASI_Hs01_00010716 predicted 430
7 SASI_Hs01_00010717 predicted 355
8 SASI_Hs01_00010719 predicted 900
9 SASI_Hs02_00367219 predicted 526
10 SASI_Hs01_00010720 predicted 494
11 SASI_Hs01_00010718 predicted 663
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014210 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00060330 predicted 291
2 SASI_Rn01_00060331 predicted 216
3 SASI_Rn01_00060332 predicted 536
4 SASI_Rn02_00201742 predicted 655
5 SASI_Rn01_00060333 predicted 437
6 SASI_Rn01_00060334 predicted 695
7 SASI_Rn01_00060336 predicted 908
8 SASI_Rn01_00060338 predicted 315
9 SASI_Rn01_00060339 predicted 703
10 SASI_Rn02_00201743 predicted 614
11 SASI_Rn01_00060335 predicted 826
12 SASI_Rn01_00060337 predicted 462
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001074771 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00347332 predicted 295
2 SASI_Rn02_00347333 predicted 221
3 SASI_Rn02_00347334 predicted 538
4 SASI_Rn02_00347335 predicted 437
5 SASI_Rn02_00347336 predicted 436
6 SASI_Rn02_00347337 predicted 690
7 SASI_Rn02_00347338 predicted 217
8 SASI_Rn02_00347339 predicted 437
9 SASI_Rn02_00347340 predicted 532
10 SASI_Rn02_00347341 predicted 716
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028854 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00334514 predicted 653
2 SASI_Mm02_00334515 predicted 699
3 SASI_Mm02_00334516 predicted 494
4 SASI_Mm02_00334517 predicted 392
5 SASI_Mm02_00334518 predicted 394
6 SASI_Mm02_00334519 predicted 254
7 SASI_Mm02_00334520 predicted 414
8 SASI_Mm02_00334521 predicted 859
9 SASI_Mm02_00334522 predicted 531
10 SASI_Mm02_00334523 predicted 280
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_134945 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00219685 predicted 677
2 SASI_Mm01_00219686 predicted 616
3 SASI_Mm01_00219687 predicted 618
4 SASI_Mm01_00219688 predicted 664
5 SASI_Mm01_00219689 predicted 614
6 SASI_Mm01_00219690 predicted 671
7 SASI_Mm01_00219691 predicted 605
8 SASI_Mm01_00219692 predicted 643
9 SASI_Mm01_00219693 predicted 624
10 SASI_Mm01_00219694 predicted 626
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_897464 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00208496 predicted 220
2 SASI_Mm01_00208497 predicted 214
3 SASI_Mm01_00208498 predicted 204
4 SASI_Mm01_00208499 predicted 208
5 SASI_Mm01_00208500 predicted 220
6 SASI_Mm01_00208501 predicted 360
7 SASI_Mm01_00208502 predicted 313
8 SASI_Mm01_00208503 predicted 250
9 SASI_Mm01_00208504 predicted 289
10 SASI_Mm01_00208505 predicted 387
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153356
TBC1D21 MISSION shRNA Bacterial Glycerol Stock
TBC1 domain family, member 21
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156340    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153356.1-694s1c1
Sequence:CCGGCCAAGAACCTAGACATGCTCACTCGAGTGAGCATGTCTAGGTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153356.1-578s1c1
Sequence:CCGGCCATGAGATGATGATGCTCTTCTCGAGAAGAGCATCATCATCTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153356.1-425s1c1
Sequence:CCGGCTTCACAGAGACTCGCAATAACTCGAGTTATTGCGAGTCTCTGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153356.1-217s1c1
Sequence:CCGGCACGGGACTTCATTTGTGTTACTCGAGTAACACAAATGAAGTCCCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153356.1-440s1c1
Sequence:CCGGCAATAACATTGCACGTGACATCTCGAGATGTCACGTGCAATGTTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158236    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153356.1-167s1c1
Sequence:CCGGCAAGACAGAATGGGACAGCTTCTCGAGAAGCTGTCCCATTCTGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157377    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153356.1-740s1c1
Sequence:CCGGCGTGTTTGCTGAGCACCTAAACTCGAGTTTAGGTGCTCAGCAAACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153356.1-822s1c1
Sequence:CCGGGCCTTCAAGTCCTTCGATGATCTCGAGATCATCGAAGGACTTGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153356.1-362s21c1
Sequence:CCGGCTACAAGGCCTTATGCCAAATCTCGAGATTTGGCATAAGGCCTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153356.1-268s21c1
Sequence:CCGGTGAGGACTGAAGCCTGGAAATCTCGAGATTTCCAGGCTTCAGTCCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153356.1-158s21c1
Sequence:CCGGACCCATTGACAAGACAGAATGCTCGAGCATTCTGTCTTGTCAATGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153356
TBC1D21 MISSION shRNA shRNA Plasmid DNA
TBC1 domain family, member 21
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156340    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153356.1-694s1c1
Sequence:CCGGCCAAGAACCTAGACATGCTCACTCGAGTGAGCATGTCTAGGTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153356.1-578s1c1
Sequence:CCGGCCATGAGATGATGATGCTCTTCTCGAGAAGAGCATCATCATCTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153356.1-425s1c1
Sequence:CCGGCTTCACAGAGACTCGCAATAACTCGAGTTATTGCGAGTCTCTGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153356.1-217s1c1
Sequence:CCGGCACGGGACTTCATTTGTGTTACTCGAGTAACACAAATGAAGTCCCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153356.1-440s1c1
Sequence:CCGGCAATAACATTGCACGTGACATCTCGAGATGTCACGTGCAATGTTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158236    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153356.1-167s1c1
Sequence:CCGGCAAGACAGAATGGGACAGCTTCTCGAGAAGCTGTCCCATTCTGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157377    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153356.1-740s1c1
Sequence:CCGGCGTGTTTGCTGAGCACCTAAACTCGAGTTTAGGTGCTCAGCAAACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153356.1-822s1c1
Sequence:CCGGGCCTTCAAGTCCTTCGATGATCTCGAGATCATCGAAGGACTTGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153356.1-362s21c1
Sequence:CCGGCTACAAGGCCTTATGCCAAATCTCGAGATTTGGCATAAGGCCTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153356.1-268s21c1
Sequence:CCGGTGAGGACTGAAGCCTGGAAATCTCGAGATTTCCAGGCTTCAGTCCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153356.1-158s21c1
Sequence:CCGGACCCATTGACAAGACAGAATGCTCGAGCATTCTGTCTTGTCAATGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153356
TBC1D21 MISSION shRNA Lentiviral Transduction Particles
TBC1 domain family, member 21
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156340    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153356.1-694s1c1
Sequence:CCGGCCAAGAACCTAGACATGCTCACTCGAGTGAGCATGTCTAGGTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153356.1-578s1c1
Sequence:CCGGCCATGAGATGATGATGCTCTTCTCGAGAAGAGCATCATCATCTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153356.1-425s1c1
Sequence:CCGGCTTCACAGAGACTCGCAATAACTCGAGTTATTGCGAGTCTCTGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153356.1-217s1c1
Sequence:CCGGCACGGGACTTCATTTGTGTTACTCGAGTAACACAAATGAAGTCCCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153356.1-440s1c1
Sequence:CCGGCAATAACATTGCACGTGACATCTCGAGATGTCACGTGCAATGTTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158236    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153356.1-167s1c1
Sequence:CCGGCAAGACAGAATGGGACAGCTTCTCGAGAAGCTGTCCCATTCTGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157377    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153356.1-740s1c1
Sequence:CCGGCGTGTTTGCTGAGCACCTAAACTCGAGTTTAGGTGCTCAGCAAACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153356.1-822s1c1
Sequence:CCGGGCCTTCAAGTCCTTCGATGATCTCGAGATCATCGAAGGACTTGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153356.1-362s21c1
Sequence:CCGGCTACAAGGCCTTATGCCAAATCTCGAGATTTGGCATAAGGCCTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153356.1-268s21c1
Sequence:CCGGTGAGGACTGAAGCCTGGAAATCTCGAGATTTCCAGGCTTCAGTCCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153356.1-158s21c1
Sequence:CCGGACCCATTGACAAGACAGAATGCTCGAGCATTCTGTCTTGTCAATGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028854
TBC1D21 MISSION shRNA Bacterial Glycerol Stock
TBC1 domain family, member 21
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028854.3-307s21c1
Sequence:CCGGGCAACAGGAGGAGGAACTATACTCGAGTATAGTTCCTCCTCCTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028854.3-179s21c1
Sequence:CCGGACGAGACTTCATTTGCATTAACTCGAGTTAATGCAAATGAAGTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028854.3-419s21c1
Sequence:CCGGCATCCAGAGGCTGTATGATAACTCGAGTTATCATACAGCCTCTGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028854.3-643s21c1
Sequence:CCGGACATCGGTGTAGGCAAGAATCCTCGAGGATTCTTGCCTACACCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028854.3-687s21c1
Sequence:CCGGACTCTACTGGACCCTGAATTTCTCGAGAAATTCAGGGTCCAGTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028854
TBC1D21 MISSION shRNA shRNA Plasmid DNA
TBC1 domain family, member 21
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028854.3-307s21c1
Sequence:CCGGGCAACAGGAGGAGGAACTATACTCGAGTATAGTTCCTCCTCCTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028854.3-179s21c1
Sequence:CCGGACGAGACTTCATTTGCATTAACTCGAGTTAATGCAAATGAAGTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028854.3-419s21c1
Sequence:CCGGCATCCAGAGGCTGTATGATAACTCGAGTTATCATACAGCCTCTGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028854.3-643s21c1
Sequence:CCGGACATCGGTGTAGGCAAGAATCCTCGAGGATTCTTGCCTACACCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028854.3-687s21c1
Sequence:CCGGACTCTACTGGACCCTGAATTTCTCGAGAAATTCAGGGTCCAGTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028854
TBC1D21 MISSION shRNA Lentiviral Transduction Particles
TBC1 domain family, member 21
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028854.3-307s21c1
Sequence:CCGGGCAACAGGAGGAGGAACTATACTCGAGTATAGTTCCTCCTCCTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028854.3-179s21c1
Sequence:CCGGACGAGACTTCATTTGCATTAACTCGAGTTAATGCAAATGAAGTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028854.3-419s21c1
Sequence:CCGGCATCCAGAGGCTGTATGATAACTCGAGTTATCATACAGCCTCTGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028854.3-643s21c1
Sequence:CCGGACATCGGTGTAGGCAAGAATCCTCGAGGATTCTTGCCTACACCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028854.3-687s21c1
Sequence:CCGGACTCTACTGGACCCTGAATTTCTCGAGAAATTCAGGGTCCAGTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks