EMAIL THIS PAGE TO A FRIEND

TBC1D22A

TBC1 domain family, member 22A

Synonyms: C22orf4 HSC79E021
Gene ID:
Mouse(223754) TBC1 domain family, member 22a
Rat(689443) TBC1 domain family, member 22a
Zebrafish(407720) TBC1 domain family, member 22a
chicken(428128) TBC1 domain family, member 22A
Horse(100049975) TBC1 domain family, member 22A
domestic cat(101096329) TBC1 domain family, member 22A
dog(474462) TBC1 domain family, member 22A
cow(618784) TBC1 domain family, member 22A
sheep(101112129) TBC1 domain family, member 22A
domestic guinea pig(100724145) TBC1 domain family, member 22A
naked mole-rat(101720272) TBC1 domain family, member 22A
92 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014346 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014346 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014346 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145476 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145476 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145476 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014346 Rosetta Predictions human pricing
XM_001070809 Rosetta Predictions rat pricing
NM_145476 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014346 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00131839 predicted 1456
2 SASI_Hs01_00131840 predicted 1076
3 SASI_Hs01_00131841 predicted 1033
4 SASI_Hs01_00131842 predicted 1095
5 SASI_Hs01_00131843 predicted 956
6 SASI_Hs01_00131844 predicted 942
7 SASI_Hs01_00131845 predicted 1083
8 SASI_Hs01_00131846 predicted 837
9 SASI_Hs01_00131847 predicted 766
10 SASI_Hs02_00345495 predicted 939
11 SASI_Hs01_00131848 predicted 1266
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070809 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00332900 predicted 404
2 SASI_Rn02_00332901 predicted 428
3 SASI_Rn02_00332902 predicted 303
4 SASI_Rn02_00332903 predicted 334
5 SASI_Rn02_00332904 predicted 309
6 SASI_Rn02_00332905 predicted 237
7 SASI_Rn02_00332906 predicted 594
8 SASI_Rn02_00332907 predicted 411
9 SASI_Rn02_00332908 predicted 306
10 SASI_Rn02_00332909 predicted 534
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145476 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00160058 predicted 928
2 SASI_Mm01_00160059 predicted 1053
3 SASI_Mm01_00160060 predicted 734
4 SASI_Mm01_00160061 predicted 1437
5 SASI_Mm01_00160062 predicted 1086
6 SASI_Mm01_00160063 predicted 209
7 SASI_Mm01_00160065 predicted 1356
8 SASI_Mm01_00160066 predicted 1021
9 SASI_Mm01_00160067 predicted 414
10 SASI_Mm02_00340880 predicted 1021
11 SASI_Mm01_00160064 predicted 823
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014346
VALIDATED
TBC1D22A MISSION shRNA Bacterial Glycerol Stock
TBC1 domain family, member 22A
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014346.1-994s21c1
Sequence:CCGGATGAGCCCTGAAGCGTTGATCCTCGAGGATCAACGCTTCAGGGCTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014346.1-844s21c1
Sequence:CCGGGGTTACCTTCCCGCCAATGTACTCGAGTACATTGGCGGGAAGGTAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014346.1-1275s21c1
Sequence:CCGGTGCCCAACCTGGGATTCAAATCTCGAGATTTGAATCCCAGGTTGGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014346.1-761s21c1
Sequence:CCGGACACGGACCTTGAGGAATTACCTCGAGGTAATTCCTCAAGGTCCGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138669    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014346.1-1261s1c1
Sequence:CCGGGACAACTACACCTTTGCCCAACTCGAGTTGGGCAAAGGTGTAGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014346.1-966s1c1
Sequence:CCGGCAGGCAGATCCACATAGACATCTCGAGATGTCTATGTGGATCTGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138538    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014346.1-945s1c1
Sequence:CCGGCGAAGTTCACCAGGACACATACTCGAGTATGTGTCCTGGTGAACTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014346.1-931s1c1
Sequence:CCGGGATTCTAGGAACGACGAAGTTCTCGAGAACTTCGTCGTTCCTAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014346.1-1105s1c1
Sequence:CCGGGATCTCGTCACTCCTTTCTTTCTCGAGAAAGAAAGGAGTGACGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014346.1-1518s1c1
Sequence:CCGGCGTGAGATGGAGGAAGGAAATCTCGAGATTTCCTTCCTCCATCTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014346.1-1080s1c1
Sequence:CCGGCAGTGGATACGTTCAGGGTATCTCGAGATACCCTGAACGTATCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014346
VALIDATED
TBC1D22A MISSION shRNA shRNA Plasmid DNA
TBC1 domain family, member 22A
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014346.1-994s21c1
Sequence:CCGGATGAGCCCTGAAGCGTTGATCCTCGAGGATCAACGCTTCAGGGCTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014346.1-844s21c1
Sequence:CCGGGGTTACCTTCCCGCCAATGTACTCGAGTACATTGGCGGGAAGGTAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014346.1-1275s21c1
Sequence:CCGGTGCCCAACCTGGGATTCAAATCTCGAGATTTGAATCCCAGGTTGGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014346.1-761s21c1
Sequence:CCGGACACGGACCTTGAGGAATTACCTCGAGGTAATTCCTCAAGGTCCGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138669    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014346.1-1261s1c1
Sequence:CCGGGACAACTACACCTTTGCCCAACTCGAGTTGGGCAAAGGTGTAGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014346.1-966s1c1
Sequence:CCGGCAGGCAGATCCACATAGACATCTCGAGATGTCTATGTGGATCTGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138538    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014346.1-945s1c1
Sequence:CCGGCGAAGTTCACCAGGACACATACTCGAGTATGTGTCCTGGTGAACTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014346.1-931s1c1
Sequence:CCGGGATTCTAGGAACGACGAAGTTCTCGAGAACTTCGTCGTTCCTAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014346.1-1105s1c1
Sequence:CCGGGATCTCGTCACTCCTTTCTTTCTCGAGAAAGAAAGGAGTGACGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014346.1-1518s1c1
Sequence:CCGGCGTGAGATGGAGGAAGGAAATCTCGAGATTTCCTTCCTCCATCTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014346.1-1080s1c1
Sequence:CCGGCAGTGGATACGTTCAGGGTATCTCGAGATACCCTGAACGTATCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014346
VALIDATED
TBC1D22A MISSION shRNA Lentiviral Transduction Particles
TBC1 domain family, member 22A
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014346.1-994s21c1
Sequence:CCGGATGAGCCCTGAAGCGTTGATCCTCGAGGATCAACGCTTCAGGGCTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014346.1-844s21c1
Sequence:CCGGGGTTACCTTCCCGCCAATGTACTCGAGTACATTGGCGGGAAGGTAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014346.1-1275s21c1
Sequence:CCGGTGCCCAACCTGGGATTCAAATCTCGAGATTTGAATCCCAGGTTGGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014346.1-761s21c1
Sequence:CCGGACACGGACCTTGAGGAATTACCTCGAGGTAATTCCTCAAGGTCCGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138669    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014346.1-1261s1c1
Sequence:CCGGGACAACTACACCTTTGCCCAACTCGAGTTGGGCAAAGGTGTAGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014346.1-966s1c1
Sequence:CCGGCAGGCAGATCCACATAGACATCTCGAGATGTCTATGTGGATCTGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138538    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014346.1-945s1c1
Sequence:CCGGCGAAGTTCACCAGGACACATACTCGAGTATGTGTCCTGGTGAACTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014346.1-931s1c1
Sequence:CCGGGATTCTAGGAACGACGAAGTTCTCGAGAACTTCGTCGTTCCTAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014346.1-1105s1c1
Sequence:CCGGGATCTCGTCACTCCTTTCTTTCTCGAGAAAGAAAGGAGTGACGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014346.1-1518s1c1
Sequence:CCGGCGTGAGATGGAGGAAGGAAATCTCGAGATTTCCTTCCTCCATCTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014346.1-1080s1c1
Sequence:CCGGCAGTGGATACGTTCAGGGTATCTCGAGATACCCTGAACGTATCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145476
VALIDATED
TBC1D22A MISSION shRNA Bacterial Glycerol Stock
TBC1 domain family, member 22A
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000250075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145476.2-569s21c1
Sequence:CCGGTTCAGAGAGCACCGGTGATACCTCGAGGTATCACCGGTGCTCTCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145476.2-939s21c1
Sequence:CCGGACGTATCGCCAGATCCATATCCTCGAGGATATGGATCTGGCGATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145476.2-208s21c1
Sequence:CCGGCACCGTTTGATCCGCTGTTACCTCGAGGTAACAGCGGATCAAACGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145476.2-1061s21c1
Sequence:CCGGTGGATACGTTCAGGGAATAAACTCGAGTTTATTCCCTGAACGTATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184011    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145476.2-210s1c1
Sequence:CCGGCCGTTTGATCCGCTGTTACATCTCGAGATGTAACAGCGGATCAAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180860    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145476.2-1806s1c1
Sequence:CCGGGCAGCCTAGTTTGATGAGATACTCGAGTATCTCATCAAACTAGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184141    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145476.2-736s1c1
Sequence:CCGGCCAACACAGACCTTGAGGAATCTCGAGATTCCTCAAGGTCTGTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145476
VALIDATED
TBC1D22A MISSION shRNA shRNA Plasmid DNA
TBC1 domain family, member 22A
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000250075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145476.2-569s21c1
Sequence:CCGGTTCAGAGAGCACCGGTGATACCTCGAGGTATCACCGGTGCTCTCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145476.2-939s21c1
Sequence:CCGGACGTATCGCCAGATCCATATCCTCGAGGATATGGATCTGGCGATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145476.2-208s21c1
Sequence:CCGGCACCGTTTGATCCGCTGTTACCTCGAGGTAACAGCGGATCAAACGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145476.2-1061s21c1
Sequence:CCGGTGGATACGTTCAGGGAATAAACTCGAGTTTATTCCCTGAACGTATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184011    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145476.2-210s1c1
Sequence:CCGGCCGTTTGATCCGCTGTTACATCTCGAGATGTAACAGCGGATCAAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180860    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145476.2-1806s1c1
Sequence:CCGGGCAGCCTAGTTTGATGAGATACTCGAGTATCTCATCAAACTAGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184141    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145476.2-736s1c1
Sequence:CCGGCCAACACAGACCTTGAGGAATCTCGAGATTCCTCAAGGTCTGTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145476
VALIDATED
TBC1D22A MISSION shRNA Lentiviral Transduction Particles
TBC1 domain family, member 22A
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000250075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145476.2-569s21c1
Sequence:CCGGTTCAGAGAGCACCGGTGATACCTCGAGGTATCACCGGTGCTCTCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145476.2-939s21c1
Sequence:CCGGACGTATCGCCAGATCCATATCCTCGAGGATATGGATCTGGCGATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145476.2-208s21c1
Sequence:CCGGCACCGTTTGATCCGCTGTTACCTCGAGGTAACAGCGGATCAAACGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145476.2-1061s21c1
Sequence:CCGGTGGATACGTTCAGGGAATAAACTCGAGTTTATTCCCTGAACGTATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184011    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145476.2-210s1c1
Sequence:CCGGCCGTTTGATCCGCTGTTACATCTCGAGATGTAACAGCGGATCAAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180860    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145476.2-1806s1c1
Sequence:CCGGGCAGCCTAGTTTGATGAGATACTCGAGTATCTCATCAAACTAGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184141    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145476.2-736s1c1
Sequence:CCGGCCAACACAGACCTTGAGGAATCTCGAGATTCCTCAAGGTCTGTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks