EMAIL THIS PAGE TO A FRIEND

TBC1D22B

TBC1 domain family, member 22B

Synonyms: C6orf197 RP4-744I24.2 dJ744I24.2
Gene ID:
Mouse(381085) TBC1 domain family, member 22B
Rat(502414) TBC1 domain family, member 22B
naked mole-rat(101705885) TBC1 domain family, member 22B
domestic guinea pig(100725135) TBC1 domain family, member 22B
cow(615878) TBC1 domain family, member 22B
sheep(101122985) TBC1 domain family, member 22B
Zebrafish(557377) TBC1 domain family, member 22B
Horse(100053945) TBC1 domain family, member 22B
domestic cat(101094267) TBC1 domain family, member 22B
dog(481773) TBC1 domain family, member 22B
chicken(421181) TBC1 domain family, member 22B
183 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198647 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198647 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198647 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017772 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017772 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017772 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017772 Rosetta Predictions human pricing
NM_001025059 Rosetta Predictions rat pricing
XM_001069956 Rosetta Predictions rat pricing
XM_001069999 Rosetta Predictions rat pricing
NM_198647 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017772 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00123569 predicted 674
2 SASI_Hs01_00123570 predicted 925
3 SASI_Hs01_00123571 predicted 995
4 SASI_Hs01_00123572 predicted 1582
5 SASI_Hs01_00123573 predicted 1301
6 SASI_Hs01_00123574 predicted 1427
7 SASI_Hs01_00123575 predicted 1069
8 SASI_Hs01_00123576 predicted 1455
9 SASI_Hs01_00123577 predicted 196
10 SASI_Hs02_00350610 predicted 944
11 SASI_Hs01_00123578 predicted 1063
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025059 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00118066 predicted 1240
2 SASI_Rn01_00118068 predicted 827
3 SASI_Rn01_00118069 predicted 785
4 SASI_Rn01_00118070 predicted 395
5 SASI_Rn02_00202989 predicted 832
6 SASI_Rn01_00118071 predicted 1071
7 SASI_Rn01_00118072 predicted 557
8 SASI_Rn01_00118073 predicted 952
9 SASI_Rn01_00118074 predicted 899
10 SASI_Rn01_00118075 predicted 220
11 SASI_Rn01_00118067 predicted 774
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069956 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00329897 predicted 1311
2 SASI_Rn02_00329898 predicted 901
3 SASI_Rn02_00329899 predicted 860
4 SASI_Rn02_00329900 predicted 473
5 SASI_Rn02_00329901 predicted 1147
6 SASI_Rn02_00329902 predicted 636
7 SASI_Rn02_00329903 predicted 1023
8 SASI_Rn02_00329904 predicted 972
9 SASI_Rn02_00329905 predicted 296
10 SASI_Rn02_00329906 predicted 972
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069999 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00330043 predicted 1314
2 SASI_Rn02_00330044 predicted 902
3 SASI_Rn02_00330045 predicted 854
4 SASI_Rn02_00330046 predicted 474
5 SASI_Rn02_00330047 predicted 906
6 SASI_Rn02_00330048 predicted 1136
7 SASI_Rn02_00330049 predicted 637
8 SASI_Rn02_00330050 predicted 1017
9 SASI_Rn02_00330051 predicted 976
10 SASI_Rn02_00330052 predicted 289
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198647 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00109750 predicted 1346
2 SASI_Mm01_00109752 predicted 887
3 SASI_Mm01_00109753 predicted 929
4 SASI_Mm01_00109754 predicted 1166
5 SASI_Mm01_00109755 predicted 657
6 SASI_Mm01_00109756 predicted 662
7 SASI_Mm01_00109758 predicted 314
8 SASI_Mm01_00109759 predicted 466
9 SASI_Mm02_00351117 predicted 723
10 SASI_Mm02_00351118 predicted 1567
11 SASI_Mm01_00109751 predicted 880
12 SASI_Mm01_00109757 predicted 508
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198647
TBC1D22B MISSION shRNA Bacterial Glycerol Stock
TBC1 domain family, member 22B
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200454    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198647.1-1211s1c1
Sequence:CCGGGCTGGACGGAATACAGGATAACTCGAGTTATCCTGTATTCCGTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197983    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198647.1-888s1c1
Sequence:CCGGCAGTATTATGACTCTCGGAATCTCGAGATTCCGAGAGTCATAATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197982    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198647.1-251s1c1
Sequence:CCGGCTTCATCAAAGAAAGGTCGAACTCGAGTTCGACCTTTCTTTGATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200095    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198647.1-2392s1c1
Sequence:CCGGCGCGTGCATGAGTTGTATGTACTCGAGTACATACAACTCATGCACGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198642    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198647.1-2364s1c1
Sequence:CCGGCGAGTATGTGTGTGTGTGTATCTCGAGATACACACACACACATACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198647.1-1095s1c1
Sequence:CCGGGTCGTCTTCCTCTCGGAATATCTCGAGATATTCCGAGAGGAAGACGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198647.1-1604s1c1
Sequence:CCGGCTACAGACTCAAGTACATGTTCTCGAGAACATGTACTTGAGTCTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181603    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198647.1-3037s1c1
Sequence:CCGGGCCTTTGTCTTCTCAGTGTAACTCGAGTTACACTGAGAAGACAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177058    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198647.1-2710s1c1
Sequence:CCGGGCACTCCAAGATATTATGTATCTCGAGATACATAATATCTTGGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219606    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198647.1-504s1c1
Sequence:CCGGGCCAACTACAAGGTCATAAAGCTCGAGCTTTATGACCTTGTAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198647
TBC1D22B MISSION shRNA shRNA Plasmid DNA
TBC1 domain family, member 22B
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200454    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198647.1-1211s1c1
Sequence:CCGGGCTGGACGGAATACAGGATAACTCGAGTTATCCTGTATTCCGTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197983    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198647.1-888s1c1
Sequence:CCGGCAGTATTATGACTCTCGGAATCTCGAGATTCCGAGAGTCATAATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197982    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198647.1-251s1c1
Sequence:CCGGCTTCATCAAAGAAAGGTCGAACTCGAGTTCGACCTTTCTTTGATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200095    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198647.1-2392s1c1
Sequence:CCGGCGCGTGCATGAGTTGTATGTACTCGAGTACATACAACTCATGCACGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198642    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198647.1-2364s1c1
Sequence:CCGGCGAGTATGTGTGTGTGTGTATCTCGAGATACACACACACACATACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198647.1-1095s1c1
Sequence:CCGGGTCGTCTTCCTCTCGGAATATCTCGAGATATTCCGAGAGGAAGACGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198647.1-1604s1c1
Sequence:CCGGCTACAGACTCAAGTACATGTTCTCGAGAACATGTACTTGAGTCTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181603    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198647.1-3037s1c1
Sequence:CCGGGCCTTTGTCTTCTCAGTGTAACTCGAGTTACACTGAGAAGACAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177058    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198647.1-2710s1c1
Sequence:CCGGGCACTCCAAGATATTATGTATCTCGAGATACATAATATCTTGGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219606    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198647.1-504s1c1
Sequence:CCGGGCCAACTACAAGGTCATAAAGCTCGAGCTTTATGACCTTGTAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198647
TBC1D22B MISSION shRNA Lentiviral Transduction Particles
TBC1 domain family, member 22B
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200454    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198647.1-1211s1c1
Sequence:CCGGGCTGGACGGAATACAGGATAACTCGAGTTATCCTGTATTCCGTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197983    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198647.1-888s1c1
Sequence:CCGGCAGTATTATGACTCTCGGAATCTCGAGATTCCGAGAGTCATAATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197982    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198647.1-251s1c1
Sequence:CCGGCTTCATCAAAGAAAGGTCGAACTCGAGTTCGACCTTTCTTTGATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200095    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198647.1-2392s1c1
Sequence:CCGGCGCGTGCATGAGTTGTATGTACTCGAGTACATACAACTCATGCACGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198642    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198647.1-2364s1c1
Sequence:CCGGCGAGTATGTGTGTGTGTGTATCTCGAGATACACACACACACATACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198647.1-1095s1c1
Sequence:CCGGGTCGTCTTCCTCTCGGAATATCTCGAGATATTCCGAGAGGAAGACGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198647.1-1604s1c1
Sequence:CCGGCTACAGACTCAAGTACATGTTCTCGAGAACATGTACTTGAGTCTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181603    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198647.1-3037s1c1
Sequence:CCGGGCCTTTGTCTTCTCAGTGTAACTCGAGTTACACTGAGAAGACAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177058    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198647.1-2710s1c1
Sequence:CCGGGCACTCCAAGATATTATGTATCTCGAGATACATAATATCTTGGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219606    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198647.1-504s1c1
Sequence:CCGGGCCAACTACAAGGTCATAAAGCTCGAGCTTTATGACCTTGTAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017772
VALIDATED
TBC1D22B MISSION shRNA Bacterial Glycerol Stock
TBC1 domain family, member 22B
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183722    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017772.2-556s1c1
Sequence:CCGGCCAGAAACTCTAGTGATACATCTCGAGATGTATCACTAGAGTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017772.2-863s21c1
Sequence:CCGGGCGGAAGCGGGAGGAATATTTCTCGAGAAATATTCCTCCCGCTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017772.2-513s21c1
Sequence:CCGGGCCAACTACAAGGTCATAAAGCTCGAGCTTTATGACCTTGTAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017772.2-781s21c1
Sequence:CCGGCCAGGGAGGTTCGACCTATAACTCGAGTTATAGGTCGAACCTCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017772.2-1304s21c1
Sequence:CCGGGATTGATGAGCAGGTACATAACTCGAGTTATGTACCTGCTCATCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243052    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017772.2-2456s21c1
Sequence:CCGGATGACCCACTCCAAGATATTACTCGAGTAATATCTTGGAGTGGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017772
VALIDATED
TBC1D22B MISSION shRNA shRNA Plasmid DNA
TBC1 domain family, member 22B
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183722    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017772.2-556s1c1
Sequence:CCGGCCAGAAACTCTAGTGATACATCTCGAGATGTATCACTAGAGTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017772.2-863s21c1
Sequence:CCGGGCGGAAGCGGGAGGAATATTTCTCGAGAAATATTCCTCCCGCTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017772.2-513s21c1
Sequence:CCGGGCCAACTACAAGGTCATAAAGCTCGAGCTTTATGACCTTGTAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017772.2-781s21c1
Sequence:CCGGCCAGGGAGGTTCGACCTATAACTCGAGTTATAGGTCGAACCTCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017772.2-1304s21c1
Sequence:CCGGGATTGATGAGCAGGTACATAACTCGAGTTATGTACCTGCTCATCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243052    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017772.2-2456s21c1
Sequence:CCGGATGACCCACTCCAAGATATTACTCGAGTAATATCTTGGAGTGGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017772
VALIDATED
TBC1D22B MISSION shRNA Lentiviral Transduction Particles
TBC1 domain family, member 22B
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183722    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017772.2-556s1c1
Sequence:CCGGCCAGAAACTCTAGTGATACATCTCGAGATGTATCACTAGAGTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017772.2-863s21c1
Sequence:CCGGGCGGAAGCGGGAGGAATATTTCTCGAGAAATATTCCTCCCGCTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017772.2-513s21c1
Sequence:CCGGGCCAACTACAAGGTCATAAAGCTCGAGCTTTATGACCTTGTAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017772.2-781s21c1
Sequence:CCGGCCAGGGAGGTTCGACCTATAACTCGAGTTATAGGTCGAACCTCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017772.2-1304s21c1
Sequence:CCGGGATTGATGAGCAGGTACATAACTCGAGTTATGTACCTGCTCATCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243052    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017772.2-2456s21c1
Sequence:CCGGATGACCCACTCCAAGATATTACTCGAGTAATATCTTGGAGTGGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks