EMAIL THIS PAGE TO A FRIEND

TBC1D23

TBC1 domain family, member 23

Synonyms: NS4ATP1
UniProtKB ID: Q9NUY8, Q8TCN8, Q8WUB7, Q96D90, Q9NV75
Gene ID:
Mouse(67581) TBC1 domain family, member 23
Rat(304019) TBC1 domain family, member 23
Zebrafish(798995) TBC1 domain family, member 23
domestic cat(101092634) TBC1 domain family, member 23
dog(478539) TBC1 domain family, member 23
chicken(418383) TBC1 domain family, member 23
cow(518370) TBC1 domain family, member 23
sheep(101108794) TBC1 domain family, member 23
domestic guinea pig(100722256) TBC1 domain family, member 23
naked mole-rat(101713393) TBC1 domain family, member 23
45 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018309 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018309 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018309 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026254 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026254 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026254 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018309 Rosetta Predictions human pricing
NM_001107099 Rosetta Predictions rat pricing
NM_026254 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018309 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00161471 predicted 836
2 SASI_Hs01_00161472 predicted 1268
3 SASI_Hs01_00161473 predicted 455
4 SASI_Hs01_00161474 predicted 526
5 SASI_Hs01_00161476 predicted 1280
6 SASI_Hs01_00161477 predicted 1145
7 SASI_Hs02_00351720 predicted 975
8 SASI_Hs01_00161478 predicted 1377
9 SASI_Hs02_00351721 predicted 497
10 SASI_Hs01_00161479 predicted 903
11 SASI_Hs01_00161475 predicted 432
12 SASI_Hs01_00161480 predicted 812
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107099 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00225486 predicted 911
2 SASI_Rn02_00225487 predicted 760
3 SASI_Rn02_00225488 predicted 1034
4 SASI_Rn02_00225489 predicted 671
5 SASI_Rn02_00225490 predicted 811
6 SASI_Rn02_00225491 predicted 655
7 SASI_Rn02_00225492 predicted 940
8 SASI_Rn02_00225493 predicted 917
9 SASI_Rn02_00225494 predicted 879
10 SASI_Rn02_00225495 predicted 255
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026254 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00074863 predicted 1205
2 SASI_Mm02_00329939 predicted 1723
3 SASI_Mm01_00074864 predicted 489
4 SASI_Mm01_00074865 predicted 1447
5 SASI_Mm01_00074866 predicted 412
6 SASI_Mm01_00074867 predicted 1440
7 SASI_Mm01_00074868 predicted 393
8 SASI_Mm01_00074869 predicted 1527
9 SASI_Mm01_00074870 predicted 1066
10 SASI_Mm01_00074872 predicted 293
11 SASI_Mm01_00074871 predicted 1028
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018309
VALIDATED
TBC1D23 MISSION shRNA Bacterial Glycerol Stock
TBC1 domain family, member 23
Human
18 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018309.2-1758s21c1
Sequence:CCGGCAAGCCTTACCGTGGCGTAAACTCGAGTTTACGCCACGGTAAGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434258    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018309.2-2488s21c1
Sequence:CCGGTGCCCTTATGGACTAAGTAAGCTCGAGCTTACTTAGTCCATAAGGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018309.2-271s21c1
Sequence:CCGGGATCTTGAAACGTTGAGAAATCTCGAGATTTCTCAACGTTTCAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018309.2-724s21c1
Sequence:CCGGTGTTCTTATCTTGATACAAAGCTCGAGCTTTGTATCAAGATAAGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414930    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018309.2-2348s21c1
Sequence:CCGGGCAGGTCTAAGAAAGTGTAAACTCGAGTTTACACTTTCTTAGACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018309.2-1807s21c1
Sequence:CCGGGAATACGACACAGATGAAATTCTCGAGAATTTCATCTGTGTCGTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418080    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018309.2-2269s21c1
Sequence:CCGGCCAAGAGAAACATGGACATATCTCGAGATATGTCCATGTTTCTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018309.2-962s21c1
Sequence:CCGGATACTCCATCCAGTCTGAATACTCGAGTATTCAGACTGGATGGAGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018309.2-1562s21c1
Sequence:CCGGGCTCAAGGAGCAGTATCAATTCTCGAGAATTGATACTGCTCCTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018309.1-265s1c1
Sequence:CCGGCCTGCAGTTTATTGACCAGCTCTCGAGAGCTGGTCAATAAACTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129987    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018309.1-1792s1c1
Sequence:CCGGGTTGGTTACTGCAACACATATCTCGAGATATGTGTTGCAGTAACCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018309.1-842s1c1
Sequence:CCGGGCTCAGTATTATTGCAGCAAACTCGAGTTTGCTGCAATAATACTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018309.1-936s1c1
Sequence:CCGGCAGATCTGAGTCAGGCTCTTTCTCGAGAAAGAGCCTGACTCAGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018309.1-623s1c1
Sequence:CCGGGCATGTTACTGTTCCACTGAACTCGAGTTCAGTGGAACAGTAACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018309.1-433s1c1
Sequence:CCGGCAGCGATTTATACAACTGCTTCTCGAGAAGCAGTTGTATAAATCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018309.1-1046s1c1
Sequence:CCGGGAACAATATAATGCTGGGCATCTCGAGATGCCCAGCATTATATTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018309.1-1850s1c1
Sequence:CCGGGCTTATATACAGTCTCGACAACTCGAGTTGTCGAGACTGTATATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018309.1-650s1c1
Sequence:CCGGCAGGCAATATGGGATGGATATCTCGAGATATCCATCCCATATTGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018309
VALIDATED
TBC1D23 MISSION shRNA shRNA Plasmid DNA
TBC1 domain family, member 23
Human
18 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018309.2-1758s21c1
Sequence:CCGGCAAGCCTTACCGTGGCGTAAACTCGAGTTTACGCCACGGTAAGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434258    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018309.2-2488s21c1
Sequence:CCGGTGCCCTTATGGACTAAGTAAGCTCGAGCTTACTTAGTCCATAAGGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018309.2-271s21c1
Sequence:CCGGGATCTTGAAACGTTGAGAAATCTCGAGATTTCTCAACGTTTCAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018309.2-724s21c1
Sequence:CCGGTGTTCTTATCTTGATACAAAGCTCGAGCTTTGTATCAAGATAAGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414930    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018309.2-2348s21c1
Sequence:CCGGGCAGGTCTAAGAAAGTGTAAACTCGAGTTTACACTTTCTTAGACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018309.2-1807s21c1
Sequence:CCGGGAATACGACACAGATGAAATTCTCGAGAATTTCATCTGTGTCGTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418080    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018309.2-2269s21c1
Sequence:CCGGCCAAGAGAAACATGGACATATCTCGAGATATGTCCATGTTTCTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018309.2-962s21c1
Sequence:CCGGATACTCCATCCAGTCTGAATACTCGAGTATTCAGACTGGATGGAGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018309.2-1562s21c1
Sequence:CCGGGCTCAAGGAGCAGTATCAATTCTCGAGAATTGATACTGCTCCTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018309.1-265s1c1
Sequence:CCGGCCTGCAGTTTATTGACCAGCTCTCGAGAGCTGGTCAATAAACTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129987    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018309.1-1792s1c1
Sequence:CCGGGTTGGTTACTGCAACACATATCTCGAGATATGTGTTGCAGTAACCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018309.1-842s1c1
Sequence:CCGGGCTCAGTATTATTGCAGCAAACTCGAGTTTGCTGCAATAATACTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018309.1-936s1c1
Sequence:CCGGCAGATCTGAGTCAGGCTCTTTCTCGAGAAAGAGCCTGACTCAGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018309.1-623s1c1
Sequence:CCGGGCATGTTACTGTTCCACTGAACTCGAGTTCAGTGGAACAGTAACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018309.1-433s1c1
Sequence:CCGGCAGCGATTTATACAACTGCTTCTCGAGAAGCAGTTGTATAAATCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018309.1-1046s1c1
Sequence:CCGGGAACAATATAATGCTGGGCATCTCGAGATGCCCAGCATTATATTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018309.1-1850s1c1
Sequence:CCGGGCTTATATACAGTCTCGACAACTCGAGTTGTCGAGACTGTATATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018309.1-650s1c1
Sequence:CCGGCAGGCAATATGGGATGGATATCTCGAGATATCCATCCCATATTGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018309
VALIDATED
TBC1D23 MISSION shRNA Lentiviral Transduction Particles
TBC1 domain family, member 23
Human
18 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018309.2-1758s21c1
Sequence:CCGGCAAGCCTTACCGTGGCGTAAACTCGAGTTTACGCCACGGTAAGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434258    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018309.2-2488s21c1
Sequence:CCGGTGCCCTTATGGACTAAGTAAGCTCGAGCTTACTTAGTCCATAAGGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018309.2-271s21c1
Sequence:CCGGGATCTTGAAACGTTGAGAAATCTCGAGATTTCTCAACGTTTCAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018309.2-724s21c1
Sequence:CCGGTGTTCTTATCTTGATACAAAGCTCGAGCTTTGTATCAAGATAAGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414930    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018309.2-2348s21c1
Sequence:CCGGGCAGGTCTAAGAAAGTGTAAACTCGAGTTTACACTTTCTTAGACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018309.2-1807s21c1
Sequence:CCGGGAATACGACACAGATGAAATTCTCGAGAATTTCATCTGTGTCGTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418080    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018309.2-2269s21c1
Sequence:CCGGCCAAGAGAAACATGGACATATCTCGAGATATGTCCATGTTTCTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018309.2-962s21c1
Sequence:CCGGATACTCCATCCAGTCTGAATACTCGAGTATTCAGACTGGATGGAGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018309.2-1562s21c1
Sequence:CCGGGCTCAAGGAGCAGTATCAATTCTCGAGAATTGATACTGCTCCTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018309.1-265s1c1
Sequence:CCGGCCTGCAGTTTATTGACCAGCTCTCGAGAGCTGGTCAATAAACTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129987    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018309.1-1792s1c1
Sequence:CCGGGTTGGTTACTGCAACACATATCTCGAGATATGTGTTGCAGTAACCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018309.1-842s1c1
Sequence:CCGGGCTCAGTATTATTGCAGCAAACTCGAGTTTGCTGCAATAATACTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018309.1-936s1c1
Sequence:CCGGCAGATCTGAGTCAGGCTCTTTCTCGAGAAAGAGCCTGACTCAGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018309.1-623s1c1
Sequence:CCGGGCATGTTACTGTTCCACTGAACTCGAGTTCAGTGGAACAGTAACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018309.1-433s1c1
Sequence:CCGGCAGCGATTTATACAACTGCTTCTCGAGAAGCAGTTGTATAAATCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018309.1-1046s1c1
Sequence:CCGGGAACAATATAATGCTGGGCATCTCGAGATGCCCAGCATTATATTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018309.1-1850s1c1
Sequence:CCGGGCTTATATACAGTCTCGACAACTCGAGTTGTCGAGACTGTATATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018309.1-650s1c1
Sequence:CCGGCAGGCAATATGGGATGGATATCTCGAGATATCCATCCCATATTGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026254
VALIDATED
TBC1D23 MISSION shRNA Bacterial Glycerol Stock
TBC1 domain family, member 23
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000413213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026254.2-194s21c1
Sequence:CCGGGATCTTGAAACTTTGAGAAATCTCGAGATTTCTCAAAGTTTCAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026254.2-1953s21c1
Sequence:CCGGAGTCTCGGCAAGCACTAAATTCTCGAGAATTTAGTGCTTGCCGAGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026254.2-444s21c1
Sequence:CCGGGTAAATCACGCAGCGTTAAATCTCGAGATTTAACGCTGCGTGATTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026254.2-1384s21c1
Sequence:CCGGCATTGCCAGTGGAGGATTTATCTCGAGATAAATCCTCCACTGGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026254.2-1508s21c1
Sequence:CCGGGTCGATGGTGAATCCTGTAATCTCGAGATTACAGGATTCACCATCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026254.2-1345s1c1
Sequence:CCGGCCTCGCACACTTCTTACAGAACTCGAGTTCTGTAAGAAGTGTGCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026254.2-2047s1c1
Sequence:CCGGCGGGATAGAAATCTTGGCTATCTCGAGATAGCCAAGATTTCTATCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026254.2-1817s1c1
Sequence:CCGGCCGGACATCAAGCATCACTTTCTCGAGAAAGTGATGCTTGATGTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026254.2-329s1c1
Sequence:CCGGCCTGAGCAGAACACTATTCATCTCGAGATGAATAGTGTTCTGCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191208    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026254.2-3489s1c1
Sequence:CCGGCCCAAACTGTTGTATTTCATTCTCGAGAATGAAATACAACAGTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026254
VALIDATED
TBC1D23 MISSION shRNA shRNA Plasmid DNA
TBC1 domain family, member 23
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000413213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026254.2-194s21c1
Sequence:CCGGGATCTTGAAACTTTGAGAAATCTCGAGATTTCTCAAAGTTTCAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026254.2-1953s21c1
Sequence:CCGGAGTCTCGGCAAGCACTAAATTCTCGAGAATTTAGTGCTTGCCGAGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026254.2-444s21c1
Sequence:CCGGGTAAATCACGCAGCGTTAAATCTCGAGATTTAACGCTGCGTGATTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026254.2-1384s21c1
Sequence:CCGGCATTGCCAGTGGAGGATTTATCTCGAGATAAATCCTCCACTGGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026254.2-1508s21c1
Sequence:CCGGGTCGATGGTGAATCCTGTAATCTCGAGATTACAGGATTCACCATCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026254.2-1345s1c1
Sequence:CCGGCCTCGCACACTTCTTACAGAACTCGAGTTCTGTAAGAAGTGTGCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026254.2-2047s1c1
Sequence:CCGGCGGGATAGAAATCTTGGCTATCTCGAGATAGCCAAGATTTCTATCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026254.2-1817s1c1
Sequence:CCGGCCGGACATCAAGCATCACTTTCTCGAGAAAGTGATGCTTGATGTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026254.2-329s1c1
Sequence:CCGGCCTGAGCAGAACACTATTCATCTCGAGATGAATAGTGTTCTGCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191208    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026254.2-3489s1c1
Sequence:CCGGCCCAAACTGTTGTATTTCATTCTCGAGAATGAAATACAACAGTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026254
VALIDATED
TBC1D23 MISSION shRNA Lentiviral Transduction Particles
TBC1 domain family, member 23
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000413213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026254.2-194s21c1
Sequence:CCGGGATCTTGAAACTTTGAGAAATCTCGAGATTTCTCAAAGTTTCAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026254.2-1953s21c1
Sequence:CCGGAGTCTCGGCAAGCACTAAATTCTCGAGAATTTAGTGCTTGCCGAGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026254.2-444s21c1
Sequence:CCGGGTAAATCACGCAGCGTTAAATCTCGAGATTTAACGCTGCGTGATTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026254.2-1384s21c1
Sequence:CCGGCATTGCCAGTGGAGGATTTATCTCGAGATAAATCCTCCACTGGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026254.2-1508s21c1
Sequence:CCGGGTCGATGGTGAATCCTGTAATCTCGAGATTACAGGATTCACCATCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026254.2-1345s1c1
Sequence:CCGGCCTCGCACACTTCTTACAGAACTCGAGTTCTGTAAGAAGTGTGCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026254.2-2047s1c1
Sequence:CCGGCGGGATAGAAATCTTGGCTATCTCGAGATAGCCAAGATTTCTATCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026254.2-1817s1c1
Sequence:CCGGCCGGACATCAAGCATCACTTTCTCGAGAAAGTGATGCTTGATGTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026254.2-329s1c1
Sequence:CCGGCCTGAGCAGAACACTATTCATCTCGAGATGAATAGTGTTCTGCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191208    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026254.2-3489s1c1
Sequence:CCGGCCCAAACTGTTGTATTTCATTCTCGAGAATGAAATACAACAGTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks