EMAIL THIS PAGE TO A FRIEND

TBC1D24

TBC1 domain family, member 24

Synonyms: EIEE16 FIME TLDC6
UniProtKB ID: Q9ULP9, A0JNW3, Q2KJ08
Gene ID:
Human(57465) Summary: This gene encodes a protein with a conserved domain, referred to as the TBC domain, characteristic of proteins which interact with GTPases. TBC domain proteins may serve as GTPase-activating proteins for a particular group of GTPases, the Rab (Ras-related proteins in brain) small GTPases which are involved in the regulation of membrane trafficking. Mutations in this gene are associated with familial infantile myoclonic epilepsy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2011]
Mouse(224617) TBC1 domain family, member 24
Rat(287110) TBC1 domain family, member 24
naked mole-rat(101707081) TBC1 domain family, member 24
Domestic Rabbit(100347456) TBC1 domain family, member 24
domestic guinea pig(100734581) TBC1 domain family, member 24
cow(529002) TBC1 domain family, member 24
sheep(101116698) TBC1 domain family, member 24
Goat(100861050) TBC1 domain family, member 24
Zebrafish(606621) TBC1 domain family, member 24
dog(609726) TBC1 domain family, member 24
Horse(100065761) TBC1 domain family, member 24
domestic cat(101101685) TBC1 domain family, member 24
chicken(100859828) TBC1 domain family, member 24
49 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173186 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173186 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173186 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020705 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020705 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020705 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020705 Rosetta Predictions human pricing
NM_001105769 Rosetta Predictions rat pricing
NM_173186 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020705 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00103901 predicted 659
2 SASI_Hs01_00103902 predicted 1327
3 SASI_Hs01_00103903 predicted 1438
4 SASI_Hs01_00103904 predicted 1083
5 SASI_Hs01_00103905 predicted 1348
6 SASI_Hs01_00103906 predicted 939
7 SASI_Hs01_00103907 predicted 2274
8 SASI_Hs01_00103908 predicted 441
9 SASI_Hs01_00103909 predicted 1689
10 SASI_Hs01_00103910 predicted 1123
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105769 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00212346 predicted 1165
2 SASI_Rn02_00212347 predicted 1269
3 SASI_Rn02_00212348 predicted 1266
4 SASI_Rn02_00212349 predicted 1662
5 SASI_Rn02_00212350 predicted 805
6 SASI_Rn02_00212351 predicted 1494
7 SASI_Rn02_00212352 predicted 1573
8 SASI_Rn02_00212353 predicted 1278
9 SASI_Rn02_00212354 predicted 1396
10 SASI_Rn02_00212355 predicted 1397
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173186 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00145836 predicted 1566
2 SASI_Mm01_00145838 predicted 618
3 SASI_Mm01_00145839 predicted 931
4 SASI_Mm01_00145840 predicted 613
5 SASI_Mm02_00345154 predicted 1079
6 SASI_Mm01_00145842 predicted 1268
7 SASI_Mm02_00345155 predicted 387
8 SASI_Mm01_00145843 predicted 1491
9 SASI_Mm01_00145844 predicted 1239
10 SASI_Mm01_00145845 predicted 285
11 SASI_Mm01_00145837 predicted 1262
12 SASI_Mm01_00145841 predicted 1270
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173186
VALIDATED
TBC1D24 MISSION shRNA Bacterial Glycerol Stock
TBC1 domain family, member 24
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200449    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173186.2-3568s1c1
Sequence:CCGGGCTCACCTCTACAGAAGGTTACTCGAGTAACCTTCTGTAGAGGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182252    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173186.2-935s1c1
Sequence:CCGGCCTCAATTACTTTGCCCGTGTCTCGAGACACGGGCAAAGTAATTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_173186.2-1208s1c1
Sequence:CCGGGCAGAAGGGTATAACTGTCAACTCGAGTTGACAGTTATACCCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178089    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173186.2-2100s1c1
Sequence:CCGGGCTTGGACTTAGGTTAGGATTCTCGAGAATCCTAACCTAAGTCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173186.2-1080s1c1
Sequence:CCGGCGAATGTTTGTCAAGGACATTCTCGAGAATGTCCTTGACAAACATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173186.2-1079s1c1
Sequence:CCGGCCGAATGTTTGTCAAGGACATCTCGAGATGTCCTTGACAAACATTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350950    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173186.3-2217s21c1
Sequence:CCGGAGGTGTCCTGTACCCACAATTCTCGAGAATTGTGGGTACAGGACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_173186.3-1136s21c1
Sequence:CCGGGCCTTTGCCATCCGCCTATTTCTCGAGAAATAGGCGGATGGCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_173186.3-1486s21c1
Sequence:CCGGCTGGAGCGAGAGGACTAAATTCTCGAGAATTTAGTCCTCTCGCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173186.3-800s21c1
Sequence:CCGGGAGTCTTCCTGTATGACATTTCTCGAGAAATGTCATACAGGAAGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173186.3-1079s21c1
Sequence:CCGGCGAATGTTTGTCAAGGACATTCTCGAGAATGTCCTTGACAAACATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173186
VALIDATED
TBC1D24 MISSION shRNA shRNA Plasmid DNA
TBC1 domain family, member 24
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200449    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173186.2-3568s1c1
Sequence:CCGGGCTCACCTCTACAGAAGGTTACTCGAGTAACCTTCTGTAGAGGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182252    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173186.2-935s1c1
Sequence:CCGGCCTCAATTACTTTGCCCGTGTCTCGAGACACGGGCAAAGTAATTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_173186.2-1208s1c1
Sequence:CCGGGCAGAAGGGTATAACTGTCAACTCGAGTTGACAGTTATACCCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178089    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173186.2-2100s1c1
Sequence:CCGGGCTTGGACTTAGGTTAGGATTCTCGAGAATCCTAACCTAAGTCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173186.2-1080s1c1
Sequence:CCGGCGAATGTTTGTCAAGGACATTCTCGAGAATGTCCTTGACAAACATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173186.2-1079s1c1
Sequence:CCGGCCGAATGTTTGTCAAGGACATCTCGAGATGTCCTTGACAAACATTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350950    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173186.3-2217s21c1
Sequence:CCGGAGGTGTCCTGTACCCACAATTCTCGAGAATTGTGGGTACAGGACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_173186.3-1136s21c1
Sequence:CCGGGCCTTTGCCATCCGCCTATTTCTCGAGAAATAGGCGGATGGCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_173186.3-1486s21c1
Sequence:CCGGCTGGAGCGAGAGGACTAAATTCTCGAGAATTTAGTCCTCTCGCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173186.3-800s21c1
Sequence:CCGGGAGTCTTCCTGTATGACATTTCTCGAGAAATGTCATACAGGAAGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173186.3-1079s21c1
Sequence:CCGGCGAATGTTTGTCAAGGACATTCTCGAGAATGTCCTTGACAAACATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173186
VALIDATED
TBC1D24 MISSION shRNA Lentiviral Transduction Particles
TBC1 domain family, member 24
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200449    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173186.2-3568s1c1
Sequence:CCGGGCTCACCTCTACAGAAGGTTACTCGAGTAACCTTCTGTAGAGGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182252    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173186.2-935s1c1
Sequence:CCGGCCTCAATTACTTTGCCCGTGTCTCGAGACACGGGCAAAGTAATTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_173186.2-1208s1c1
Sequence:CCGGGCAGAAGGGTATAACTGTCAACTCGAGTTGACAGTTATACCCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178089    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173186.2-2100s1c1
Sequence:CCGGGCTTGGACTTAGGTTAGGATTCTCGAGAATCCTAACCTAAGTCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173186.2-1080s1c1
Sequence:CCGGCGAATGTTTGTCAAGGACATTCTCGAGAATGTCCTTGACAAACATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173186.2-1079s1c1
Sequence:CCGGCCGAATGTTTGTCAAGGACATCTCGAGATGTCCTTGACAAACATTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350950    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173186.3-2217s21c1
Sequence:CCGGAGGTGTCCTGTACCCACAATTCTCGAGAATTGTGGGTACAGGACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_173186.3-1136s21c1
Sequence:CCGGGCCTTTGCCATCCGCCTATTTCTCGAGAAATAGGCGGATGGCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_173186.3-1486s21c1
Sequence:CCGGCTGGAGCGAGAGGACTAAATTCTCGAGAATTTAGTCCTCTCGCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173186.3-800s21c1
Sequence:CCGGGAGTCTTCCTGTATGACATTTCTCGAGAAATGTCATACAGGAAGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173186.3-1079s21c1
Sequence:CCGGCGAATGTTTGTCAAGGACATTCTCGAGAATGTCCTTGACAAACATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020705
VALIDATED
TBC1D24 MISSION shRNA Bacterial Glycerol Stock
TBC1 domain family, member 24
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_020705.1-1391s21c1
Sequence:CCGGCTTCTTTGGGACCGGAGAATGCTCGAGCATTCTCCGGTCCCAAAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245855    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_020705.1-4024s21c1
Sequence:CCGGATTGCTGCTGGGTCATGATTTCTCGAGAAATCATGACCCAGCAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020705.1-748s21c1
Sequence:CCGGAGGATGTCCTGCAGGTCTATGCTCGAGCATAGACCTGCAGGACATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_020705.1-1048s21c1
Sequence:CCGGTGCAGATGGCCAATGAGAAAGCTCGAGCTTTCTCATTGGCCATCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_020705.1-1357s21c1
Sequence:CCGGGGAGTGAGAGAAATAAGTTTGCTCGAGCAAACTTATTTCTCTCACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020705
VALIDATED
TBC1D24 MISSION shRNA shRNA Plasmid DNA
TBC1 domain family, member 24
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_020705.1-1391s21c1
Sequence:CCGGCTTCTTTGGGACCGGAGAATGCTCGAGCATTCTCCGGTCCCAAAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245855    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_020705.1-4024s21c1
Sequence:CCGGATTGCTGCTGGGTCATGATTTCTCGAGAAATCATGACCCAGCAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020705.1-748s21c1
Sequence:CCGGAGGATGTCCTGCAGGTCTATGCTCGAGCATAGACCTGCAGGACATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_020705.1-1048s21c1
Sequence:CCGGTGCAGATGGCCAATGAGAAAGCTCGAGCTTTCTCATTGGCCATCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_020705.1-1357s21c1
Sequence:CCGGGGAGTGAGAGAAATAAGTTTGCTCGAGCAAACTTATTTCTCTCACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020705
VALIDATED
TBC1D24 MISSION shRNA Lentiviral Transduction Particles
TBC1 domain family, member 24
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_020705.1-1391s21c1
Sequence:CCGGCTTCTTTGGGACCGGAGAATGCTCGAGCATTCTCCGGTCCCAAAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245855    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_020705.1-4024s21c1
Sequence:CCGGATTGCTGCTGGGTCATGATTTCTCGAGAAATCATGACCCAGCAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020705.1-748s21c1
Sequence:CCGGAGGATGTCCTGCAGGTCTATGCTCGAGCATAGACCTGCAGGACATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_020705.1-1048s21c1
Sequence:CCGGTGCAGATGGCCAATGAGAAAGCTCGAGCTTTCTCATTGGCCATCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_020705.1-1357s21c1
Sequence:CCGGGGAGTGAGAGAAATAAGTTTGCTCGAGCAAACTTATTTCTCTCACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks