EMAIL THIS PAGE TO A FRIEND

TBC1D25

TBC1 domain family, member 25

Synonyms: MG81 OATL1
UniProtKB ID: Q3MII6, Q08AN9, Q3MII4, Q8TAR9
Gene ID:
Human(4943) Summary: This gene encodes a protein with a TBC domain and may function as a Rab GTPase activating protein. This gene was previously known as ornithine aminotransferase-like 1, but has no similarity to ornithine aminotransferase. [provided by RefSeq, Jul 2008]
Mouse(209815) TBC1 domain family, member 25
Rat(302552) TBC1 domain family, member 25
Zebrafish(556338) TBC1 domain family, member 25
Horse(100061931) TBC1 domain family, member 25
domestic cat(101094825) TBC1 domain family, member 25
dog(491866) TBC1 domain family, member 25
cow(515568) TBC1 domain family, member 25
sheep(101111775) TBC1 domain family, member 25
domestic guinea pig(100716875) TBC1 domain family, member 25
naked mole-rat(101702425) TBC1 domain family, member 25
138 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA029197 Anti-TBC1D25 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB2104400 Anti-TBC1D25, (N-terminal) antibody produced in rabbit affinity isolated antibody mouse, horse, rabbit, bovine, human, zebrafish, guinea pig, rat
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_047025 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_047025 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_047025 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172478 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172478 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172478 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU006871 MISSION® esiRNA esiRNA targeting human TBC1D25 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001006113 Rosetta Predictions human pricing
NM_002536 Rosetta Predictions human pricing
NM_001106955 Rosetta Predictions rat pricing
NM_172478 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006113 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00185208 predicted 613
2 SASI_Hs01_00185209 predicted 647
3 SASI_Hs01_00185210 predicted 694
4 SASI_Hs01_00185211 predicted 402
5 SASI_Hs01_00185212 predicted 259
6 SASI_Hs01_00185213 predicted 359
7 SASI_Hs01_00185214 predicted 425
8 SASI_Hs01_00185215 predicted 449
9 SASI_Hs01_00185216 predicted 293
10 SASI_Hs01_00185217 predicted 551
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002536 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00334017 predicted 1313
2 SASI_Hs02_00334018 predicted 708
3 SASI_Hs01_00034987 predicted 2042
4 SASI_Hs02_00334019 predicted 505
5 SASI_Hs01_00034989 predicted 1356
6 SASI_Hs01_00034992 predicted 2105
7 SASI_Hs02_00334020 predicted 629
8 SASI_Hs02_00334021 predicted 1883
9 SASI_Hs02_00334022 predicted 2276
10 SASI_Hs02_00334023 predicted 1644
11 SASI_Hs01_00034985 predicted 1941
12 SASI_Hs01_00034986 predicted 1966
13 SASI_Hs01_00034988 predicted 2129
14 SASI_Hs01_00034990 predicted 747
15 SASI_Hs01_00034991 predicted 1644
16 SASI_Hs01_00034993 predicted 781
17 SASI_Hs01_00034994 predicted 1155
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106955 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00224056 predicted 1301
2 SASI_Rn02_00224057 predicted 1028
3 SASI_Rn02_00224058 predicted 625
4 SASI_Rn02_00224059 predicted 262
5 SASI_Rn02_00224060 predicted 1571
6 SASI_Rn02_00224061 predicted 920
7 SASI_Rn02_00224062 predicted 660
8 SASI_Rn02_00224063 predicted 2044
9 SASI_Rn02_00224064 predicted 1003
10 SASI_Rn02_00224065 predicted 397
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172478 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00159297 predicted 1597
2 SASI_Mm01_00159298 predicted 271
3 SASI_Mm01_00159299 predicted 2343
4 SASI_Mm01_00159300 predicted 561
5 SASI_Mm01_00159301 predicted 1190
6 SASI_Mm02_00344030 predicted 801
7 SASI_Mm01_00159302 predicted 1360
8 SASI_Mm01_00159303 predicted 1815
9 SASI_Mm01_00159304 predicted 1296
10 SASI_Mm01_00159305 predicted 1881
11 SASI_Mm01_00159306 predicted 2370
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_047025
TBC1D25 MISSION shRNA Bacterial Glycerol Stock
TBC1 domain family, member 25
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_047025.7-399s1c1
Sequence:CCGGCCTCCAAACCTTACCTGCAATCTCGAGATTGCAGGTAAGGTTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_047025.7-457s1c1
Sequence:CCGGGCTAGAAGACTGGGACATAATCTCGAGATTATGTCCCAGTCTTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_047025.7-1591s1c1
Sequence:CCGGCCAGCAACTCAGGGATAACATCTCGAGATGTTATCCCTGAGTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_047025.7-661s1c1
Sequence:CCGGCGATGCTGAGTTTCACACGTACTCGAGTACGTGTGAAACTCAGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_047025.7-1782s1c1
Sequence:CCGGCTGGTGATATGGCTGTAGGATCTCGAGATCCTACAGCCATATCACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_047025
TBC1D25 MISSION shRNA shRNA Plasmid DNA
TBC1 domain family, member 25
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_047025.7-399s1c1
Sequence:CCGGCCTCCAAACCTTACCTGCAATCTCGAGATTGCAGGTAAGGTTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_047025.7-457s1c1
Sequence:CCGGGCTAGAAGACTGGGACATAATCTCGAGATTATGTCCCAGTCTTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_047025.7-1591s1c1
Sequence:CCGGCCAGCAACTCAGGGATAACATCTCGAGATGTTATCCCTGAGTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_047025.7-661s1c1
Sequence:CCGGCGATGCTGAGTTTCACACGTACTCGAGTACGTGTGAAACTCAGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_047025.7-1782s1c1
Sequence:CCGGCTGGTGATATGGCTGTAGGATCTCGAGATCCTACAGCCATATCACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_047025
TBC1D25 MISSION shRNA Lentiviral Transduction Particles
TBC1 domain family, member 25
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_047025.7-399s1c1
Sequence:CCGGCCTCCAAACCTTACCTGCAATCTCGAGATTGCAGGTAAGGTTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_047025.7-457s1c1
Sequence:CCGGGCTAGAAGACTGGGACATAATCTCGAGATTATGTCCCAGTCTTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_047025.7-1591s1c1
Sequence:CCGGCCAGCAACTCAGGGATAACATCTCGAGATGTTATCCCTGAGTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_047025.7-661s1c1
Sequence:CCGGCGATGCTGAGTTTCACACGTACTCGAGTACGTGTGAAACTCAGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_047025.7-1782s1c1
Sequence:CCGGCTGGTGATATGGCTGTAGGATCTCGAGATCCTACAGCCATATCACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172478
VALIDATED
TBC1D25 MISSION shRNA Bacterial Glycerol Stock
TBC1 domain family, member 25
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119742    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172478.1-2471s1c1
Sequence:CCGGGCCTACACATGAGACCTTATTCTCGAGAATAAGGTCTCATGTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172478.1-1879s1c1
Sequence:CCGGCCAACAACTCAGGGATAACATCTCGAGATGTTATCCCTGAGTTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172478.1-295s1c1
Sequence:CCGGCGTTAGGGTACGGGTAACTATCTCGAGATAGTTACCCGTACCCTAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172478.1-2094s1c1
Sequence:CCGGCCTTAATGCAAGAGGTAGGTTCTCGAGAACCTACCTCTTGCATTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172478.1-745s1c1
Sequence:CCGGGCTGGAAGACTGGGACATAATCTCGAGATTATGTCCCAGTCTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172478
VALIDATED
TBC1D25 MISSION shRNA shRNA Plasmid DNA
TBC1 domain family, member 25
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119742    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172478.1-2471s1c1
Sequence:CCGGGCCTACACATGAGACCTTATTCTCGAGAATAAGGTCTCATGTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172478.1-1879s1c1
Sequence:CCGGCCAACAACTCAGGGATAACATCTCGAGATGTTATCCCTGAGTTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172478.1-295s1c1
Sequence:CCGGCGTTAGGGTACGGGTAACTATCTCGAGATAGTTACCCGTACCCTAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172478.1-2094s1c1
Sequence:CCGGCCTTAATGCAAGAGGTAGGTTCTCGAGAACCTACCTCTTGCATTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172478.1-745s1c1
Sequence:CCGGGCTGGAAGACTGGGACATAATCTCGAGATTATGTCCCAGTCTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172478
VALIDATED
TBC1D25 MISSION shRNA Lentiviral Transduction Particles
TBC1 domain family, member 25
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119742    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172478.1-2471s1c1
Sequence:CCGGGCCTACACATGAGACCTTATTCTCGAGAATAAGGTCTCATGTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172478.1-1879s1c1
Sequence:CCGGCCAACAACTCAGGGATAACATCTCGAGATGTTATCCCTGAGTTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172478.1-295s1c1
Sequence:CCGGCGTTAGGGTACGGGTAACTATCTCGAGATAGTTACCCGTACCCTAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172478.1-2094s1c1
Sequence:CCGGCCTTAATGCAAGAGGTAGGTTCTCGAGAACCTACCTCTTGCATTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172478.1-745s1c1
Sequence:CCGGGCTGGAAGACTGGGACATAATCTCGAGATTATGTCCCAGTCTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks