EMAIL THIS PAGE TO A FRIEND

TBC1D26

TBC1 domain family, member 26

Species: Human TBC1D26(353149)
UniProtKB ID: Q86UD7, A8K929, Q4G172
Gene ID:
28 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178571 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178571 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178571 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178571 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178571 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00175336 predicted 903
2 SASI_Hs02_00369821 predicted 864
3 SASI_Hs02_00369822 predicted 854
4 SASI_Hs01_00175337 predicted 385
5 SASI_Hs01_00175339 predicted 263
6 SASI_Hs01_00175340 predicted 709
7 SASI_Hs01_00175341 predicted 1056
8 SASI_Hs01_00175342 predicted 755
9 SASI_Hs01_00175343 predicted 700
10 SASI_Hs01_00175344 predicted 732
11 SASI_Hs01_00175338 predicted 618
12 SASI_Hs01_00175345 predicted 480
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178571
TBC1D26 MISSION shRNA Bacterial Glycerol Stock
TBC1 domain family, member 26
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118512    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178571.2-1054s1c1
Sequence:CCGGCGGTGTTTCCTTGATGGGAAACTCGAGTTTCCCATCAAGGAAACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178571.2-616s1c1
Sequence:CCGGCCCAGGCAAATATAAGGTCATCTCGAGATGACCTTATATTTGCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178571.2-907s1c1
Sequence:CCGGGTGGTATTCTACAGCCCAAATCTCGAGATTTGGGCTGTAGAATACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178571.2-766s1c1
Sequence:CCGGCGTGGCCTATTCTGCATATAACTCGAGTTATATGCAGAATAGGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178571.2-906s1c1
Sequence:CCGGTGTGGTATTCTACAGCCCAAACTCGAGTTTGGGCTGTAGAATACCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000443267    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178571.4-1427s21c1
Sequence:CCGGATGCACACCCAAGTCAGAAGGCTCGAGCCTTCTGACTTGGGTGTGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433768    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178571.4-1454s21c1
Sequence:CCGGTGAATCCTGGATGTCACCTTCCTCGAGGAAGGTGACATCCAGGATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000440427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178571.4-862s21c1
Sequence:CCGGAGATGCTTTCTGGGCGCTTACCTCGAGGTAAGCGCCCAGAAAGCATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178571
TBC1D26 MISSION shRNA shRNA Plasmid DNA
TBC1 domain family, member 26
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118512    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178571.2-1054s1c1
Sequence:CCGGCGGTGTTTCCTTGATGGGAAACTCGAGTTTCCCATCAAGGAAACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178571.2-616s1c1
Sequence:CCGGCCCAGGCAAATATAAGGTCATCTCGAGATGACCTTATATTTGCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178571.2-907s1c1
Sequence:CCGGGTGGTATTCTACAGCCCAAATCTCGAGATTTGGGCTGTAGAATACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178571.2-766s1c1
Sequence:CCGGCGTGGCCTATTCTGCATATAACTCGAGTTATATGCAGAATAGGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178571.2-906s1c1
Sequence:CCGGTGTGGTATTCTACAGCCCAAACTCGAGTTTGGGCTGTAGAATACCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000443267    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178571.4-1427s21c1
Sequence:CCGGATGCACACCCAAGTCAGAAGGCTCGAGCCTTCTGACTTGGGTGTGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433768    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178571.4-1454s21c1
Sequence:CCGGTGAATCCTGGATGTCACCTTCCTCGAGGAAGGTGACATCCAGGATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000440427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178571.4-862s21c1
Sequence:CCGGAGATGCTTTCTGGGCGCTTACCTCGAGGTAAGCGCCCAGAAAGCATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178571
TBC1D26 MISSION shRNA Lentiviral Transduction Particles
TBC1 domain family, member 26
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118512    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178571.2-1054s1c1
Sequence:CCGGCGGTGTTTCCTTGATGGGAAACTCGAGTTTCCCATCAAGGAAACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178571.2-616s1c1
Sequence:CCGGCCCAGGCAAATATAAGGTCATCTCGAGATGACCTTATATTTGCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178571.2-907s1c1
Sequence:CCGGGTGGTATTCTACAGCCCAAATCTCGAGATTTGGGCTGTAGAATACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178571.2-766s1c1
Sequence:CCGGCGTGGCCTATTCTGCATATAACTCGAGTTATATGCAGAATAGGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178571.2-906s1c1
Sequence:CCGGTGTGGTATTCTACAGCCCAAACTCGAGTTTGGGCTGTAGAATACCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000443267    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178571.4-1427s21c1
Sequence:CCGGATGCACACCCAAGTCAGAAGGCTCGAGCCTTCTGACTTGGGTGTGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433768    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178571.4-1454s21c1
Sequence:CCGGTGAATCCTGGATGTCACCTTCCTCGAGGAAGGTGACATCCAGGATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000440427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178571.4-862s21c1
Sequence:CCGGAGATGCTTTCTGGGCGCTTACCTCGAGGTAAGCGCCCAGAAAGCATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks