EMAIL THIS PAGE TO A FRIEND

TBC1D28

TBC1 domain family, member 28

Species: Human TBC1D28(254272)
UniProtKB ID: Q2M2D7, Q2M2E1
Gene ID:
23 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001039397 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001039397 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001039397 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU105311 MISSION® esiRNA esiRNA human TBC1D28 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039397 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039397 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00308501 predicted 1049
2 SASI_Hs01_00126377 predicted 542
3 SASI_Hs01_00126379 predicted 873
4 SASI_Hs02_00308502 predicted 962
5 SASI_Hs01_00126380 predicted 696
6 SASI_Hs02_00308503 predicted 956
7 SASI_Hs02_00308504 predicted 922
8 SASI_Hs02_00308505 predicted 942
9 SASI_Hs02_00308506 predicted 895
10 SASI_Hs02_00308507 predicted 946
11 SASI_Hs01_00126374 predicted 293
12 SASI_Hs01_00126375 predicted 351
13 SASI_Hs01_00126376 predicted 349
14 SASI_Hs01_00126378 predicted 444
15 SASI_Hs01_00126381 predicted 479
16 SASI_Hs01_00126382 predicted 316
17 SASI_Hs01_00126383 predicted 282
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039397
TBC1D28 MISSION shRNA Bacterial Glycerol Stock
TBC1 domain family, member 28
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039397.2-988s21c1
Sequence:CCGGGTACCTGTGCCCATATTCACACTCGAGTGTGAATATGGGCACAGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245872    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039397.2-1769s21c1
Sequence:CCGGTCACCGTGTTTCATGCTATTTCTCGAGAAATAGCATGAAACACGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039397.2-947s21c1
Sequence:CCGGGCATATAACCCTGTGAGTATTCTCGAGAATACTCACAGGGTTATATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039397.2-1027s21c1
Sequence:CCGGGGGTGTTGCAACTTCTTGAAACTCGAGTTTCAAGAAGTTGCAACACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039397.2-1002s21c1
Sequence:CCGGATTCACAGGCATGGGTGTCTCCTCGAGGAGACACCCATGCCTGTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039397
TBC1D28 MISSION shRNA shRNA Plasmid DNA
TBC1 domain family, member 28
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039397.2-988s21c1
Sequence:CCGGGTACCTGTGCCCATATTCACACTCGAGTGTGAATATGGGCACAGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245872    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039397.2-1769s21c1
Sequence:CCGGTCACCGTGTTTCATGCTATTTCTCGAGAAATAGCATGAAACACGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039397.2-947s21c1
Sequence:CCGGGCATATAACCCTGTGAGTATTCTCGAGAATACTCACAGGGTTATATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039397.2-1027s21c1
Sequence:CCGGGGGTGTTGCAACTTCTTGAAACTCGAGTTTCAAGAAGTTGCAACACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039397.2-1002s21c1
Sequence:CCGGATTCACAGGCATGGGTGTCTCCTCGAGGAGACACCCATGCCTGTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039397
TBC1D28 MISSION shRNA Lentiviral Transduction Particles
TBC1 domain family, member 28
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039397.2-988s21c1
Sequence:CCGGGTACCTGTGCCCATATTCACACTCGAGTGTGAATATGGGCACAGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245872    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039397.2-1769s21c1
Sequence:CCGGTCACCGTGTTTCATGCTATTTCTCGAGAAATAGCATGAAACACGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039397.2-947s21c1
Sequence:CCGGGCATATAACCCTGTGAGTATTCTCGAGAATACTCACAGGGTTATATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039397.2-1027s21c1
Sequence:CCGGGGGTGTTGCAACTTCTTGAAACTCGAGTTTCAAGAAGTTGCAACACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039397.2-1002s21c1
Sequence:CCGGATTCACAGGCATGGGTGTCTCCTCGAGGAGACACCCATGCCTGTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks