EMAIL THIS PAGE TO A FRIEND

TBC1D29

TBC1 domain family, member 29

Species: Human TBC1D29(26083)
UniProtKB ID: Q9UFV1
Gene ID:
15 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015594 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015594 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015594 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015594 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015594 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00127628 predicted 301
2 SASI_Hs01_00127629 predicted 248
3 SASI_Hs01_00127630 predicted 296
4 SASI_Hs01_00127631 predicted 275
5 SASI_Hs01_00127632 predicted 303
6 SASI_Hs01_00127633 predicted 293
7 SASI_Hs01_00127634 predicted 278
8 SASI_Hs01_00127635 predicted 314
9 SASI_Hs01_00127636 predicted 238
10 SASI_Hs01_00127637 predicted 318
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015594
TBC1D29 MISSION shRNA Bacterial Glycerol Stock
TBC1 domain family, member 29
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000424036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015594.2-304s21c1
Sequence:CCGGGCATTGCCTTTAAGGTTCAAACTCGAGTTTGAACCTTAAAGGCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015594.2-402s21c1
Sequence:CCGGAGACCCATTTGTGAGAGCCTCCTCGAGGAGGCTCTCACAAATGGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118332    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015594.1-2967s1c1
Sequence:CCGGCAGCAGGAAAACATGAACAAACTCGAGTTTGTTCATGTTTTCCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015594.1-2887s1c1
Sequence:CCGGGTGTCTCATTATCTCTACCATCTCGAGATGGTAGAGATAATGAGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015594.1-2558s1c1
Sequence:CCGGCCGGGTGCTGAATGATGGGATCTCGAGATCCCATCATTCAGCACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015594.1-2670s1c1
Sequence:CCGGCAAAGGAGCCTCTATGAAGAACTCGAGTTCTTCATAGAGGCTCCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015594.1-2876s1c1
Sequence:CCGGCAAGGGAATCAGTGTCTCATTCTCGAGAATGAGACACTGATTCCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015594
TBC1D29 MISSION shRNA shRNA Plasmid DNA
TBC1 domain family, member 29
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000424036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015594.2-304s21c1
Sequence:CCGGGCATTGCCTTTAAGGTTCAAACTCGAGTTTGAACCTTAAAGGCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015594.2-402s21c1
Sequence:CCGGAGACCCATTTGTGAGAGCCTCCTCGAGGAGGCTCTCACAAATGGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118332    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015594.1-2967s1c1
Sequence:CCGGCAGCAGGAAAACATGAACAAACTCGAGTTTGTTCATGTTTTCCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015594.1-2887s1c1
Sequence:CCGGGTGTCTCATTATCTCTACCATCTCGAGATGGTAGAGATAATGAGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015594.1-2558s1c1
Sequence:CCGGCCGGGTGCTGAATGATGGGATCTCGAGATCCCATCATTCAGCACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015594.1-2670s1c1
Sequence:CCGGCAAAGGAGCCTCTATGAAGAACTCGAGTTCTTCATAGAGGCTCCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015594.1-2876s1c1
Sequence:CCGGCAAGGGAATCAGTGTCTCATTCTCGAGAATGAGACACTGATTCCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015594
TBC1D29 MISSION shRNA Lentiviral Transduction Particles
TBC1 domain family, member 29
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000424036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015594.2-304s21c1
Sequence:CCGGGCATTGCCTTTAAGGTTCAAACTCGAGTTTGAACCTTAAAGGCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015594.2-402s21c1
Sequence:CCGGAGACCCATTTGTGAGAGCCTCCTCGAGGAGGCTCTCACAAATGGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118332    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015594.1-2967s1c1
Sequence:CCGGCAGCAGGAAAACATGAACAAACTCGAGTTTGTTCATGTTTTCCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015594.1-2887s1c1
Sequence:CCGGGTGTCTCATTATCTCTACCATCTCGAGATGGTAGAGATAATGAGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015594.1-2558s1c1
Sequence:CCGGCCGGGTGCTGAATGATGGGATCTCGAGATCCCATCATTCAGCACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015594.1-2670s1c1
Sequence:CCGGCAAAGGAGCCTCTATGAAGAACTCGAGTTCTTCATAGAGGCTCCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015594.1-2876s1c1
Sequence:CCGGCAAGGGAATCAGTGTCTCATTCTCGAGAATGAGACACTGATTCCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks