EMAIL THIS PAGE TO A FRIEND

TBC1D2

TBC1 domain family, member 2

Synonyms: PARIS-1 PARIS1 TBC1D2A
Gene ID:
Mouse(381605) TBC1 domain family, member 2
Rat(313234) TBC1 domain family, member 2
naked mole-rat(101720268) TBC1 domain family, member 2
domestic guinea pig(100717279) TBC1 domain family, member 2
cow(513828) TBC1 domain family, member 2
sheep(101102700) TBC1 domain family, member 2
Zebrafish(561110) TBC1 domain family, member 2
chicken(427374) TBC1 domain family, member 2
dog(481626) TBC1 domain family, member 2
domestic cat(101083375) TBC1 domain family, member 2
56 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018421 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018421 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018421 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_198664 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198664 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198664 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU139611 MISSION® esiRNA esiRNA human TBC1D2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018421 Rosetta Predictions human pricing
NM_001107933 Rosetta Predictions rat pricing
NM_198664 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018421 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00244924 predicted 931
2 SASI_Hs01_00244925 predicted 497
3 SASI_Hs01_00244926 predicted 218
4 SASI_Hs01_00244927 predicted 2553
5 SASI_Hs01_00244928 predicted 971
6 SASI_Hs01_00244929 predicted 2469
7 SASI_Hs01_00244930 predicted 2091
8 SASI_Hs01_00244931 predicted 1605
9 SASI_Hs01_00244932 predicted 1968
10 SASI_Hs01_00244933 predicted 2635
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107933 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00233715 predicted 2279
2 SASI_Rn02_00233716 predicted 2220
3 SASI_Rn02_00233717 predicted 789
4 SASI_Rn02_00233718 predicted 1861
5 SASI_Rn02_00233719 predicted 1893
6 SASI_Rn02_00233720 predicted 1520
7 SASI_Rn02_00233721 predicted 2399
8 SASI_Rn02_00233722 predicted 2186
9 SASI_Rn02_00233723 predicted 470
10 SASI_Rn02_00233724 predicted 469
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198664 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00112494 predicted 290
2 SASI_Mm01_00112495 predicted 272
3 SASI_Mm02_00351145 predicted 2758
4 SASI_Mm01_00112497 predicted 290
5 SASI_Mm01_00112498 predicted 1126
6 SASI_Mm01_00112499 predicted 569
7 SASI_Mm01_00112500 predicted 2184
8 SASI_Mm01_00112501 predicted 2956
9 SASI_Mm01_00112502 predicted 2549
10 SASI_Mm01_00112503 predicted 2218
11 SASI_Mm01_00112496 predicted 1424
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018421
TBC1D2 MISSION shRNA Bacterial Glycerol Stock
TBC1 domain family, member 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183799    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018421.1-1909s1c1
Sequence:CCGGCATCAGTAAGTATGATGAGTACTCGAGTACTCATCATACTTACTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181129    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018421.1-2794s1c1
Sequence:CCGGCTTCACCAAGACCATCTCCAACTCGAGTTGGAGATGGTCTTGGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180592    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018421.1-2821s1c1
Sequence:CCGGGAAGCTGATGAACATCGCCTTCTCGAGAAGGCGATGTTCATCAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178781    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018421.1-2833s1c1
Sequence:CCGGCATCGCCTTCAATGACATGAACTCGAGTTCATGTCATTGAAGGCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018421.3-521s21c1
Sequence:CCGGAGACTCCCAGCCGGGTTATTACTCGAGTAATAACCCGGCTGGGAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018421.3-1008s21c1
Sequence:CCGGGACCATCAGTTTCGCTCAGAACTCGAGTTCTGAGCGAAACTGATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018421.3-469s21c1
Sequence:CCGGAGTGCAGTGTTTGACTGTAAGCTCGAGCTTACAGTCAAACACTGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018421.3-400s21c1
Sequence:CCGGAGGAAATGTCAGCTGTATTACCTCGAGGTAATACAGCTGACATTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018421.3-1128s21c1
Sequence:CCGGGATGCTCACCAAGGAGTTAAACTCGAGTTTAACTCCTTGGTGAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018421
TBC1D2 MISSION shRNA shRNA Plasmid DNA
TBC1 domain family, member 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183799    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018421.1-1909s1c1
Sequence:CCGGCATCAGTAAGTATGATGAGTACTCGAGTACTCATCATACTTACTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181129    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018421.1-2794s1c1
Sequence:CCGGCTTCACCAAGACCATCTCCAACTCGAGTTGGAGATGGTCTTGGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180592    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018421.1-2821s1c1
Sequence:CCGGGAAGCTGATGAACATCGCCTTCTCGAGAAGGCGATGTTCATCAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178781    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018421.1-2833s1c1
Sequence:CCGGCATCGCCTTCAATGACATGAACTCGAGTTCATGTCATTGAAGGCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018421.3-521s21c1
Sequence:CCGGAGACTCCCAGCCGGGTTATTACTCGAGTAATAACCCGGCTGGGAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018421.3-1008s21c1
Sequence:CCGGGACCATCAGTTTCGCTCAGAACTCGAGTTCTGAGCGAAACTGATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018421.3-469s21c1
Sequence:CCGGAGTGCAGTGTTTGACTGTAAGCTCGAGCTTACAGTCAAACACTGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018421.3-400s21c1
Sequence:CCGGAGGAAATGTCAGCTGTATTACCTCGAGGTAATACAGCTGACATTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018421.3-1128s21c1
Sequence:CCGGGATGCTCACCAAGGAGTTAAACTCGAGTTTAACTCCTTGGTGAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018421
TBC1D2 MISSION shRNA Lentiviral Transduction Particles
TBC1 domain family, member 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183799    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018421.1-1909s1c1
Sequence:CCGGCATCAGTAAGTATGATGAGTACTCGAGTACTCATCATACTTACTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181129    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018421.1-2794s1c1
Sequence:CCGGCTTCACCAAGACCATCTCCAACTCGAGTTGGAGATGGTCTTGGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180592    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018421.1-2821s1c1
Sequence:CCGGGAAGCTGATGAACATCGCCTTCTCGAGAAGGCGATGTTCATCAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178781    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018421.1-2833s1c1
Sequence:CCGGCATCGCCTTCAATGACATGAACTCGAGTTCATGTCATTGAAGGCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018421.3-521s21c1
Sequence:CCGGAGACTCCCAGCCGGGTTATTACTCGAGTAATAACCCGGCTGGGAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018421.3-1008s21c1
Sequence:CCGGGACCATCAGTTTCGCTCAGAACTCGAGTTCTGAGCGAAACTGATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018421.3-469s21c1
Sequence:CCGGAGTGCAGTGTTTGACTGTAAGCTCGAGCTTACAGTCAAACACTGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018421.3-400s21c1
Sequence:CCGGAGGAAATGTCAGCTGTATTACCTCGAGGTAATACAGCTGACATTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018421.3-1128s21c1
Sequence:CCGGGATGCTCACCAAGGAGTTAAACTCGAGTTTAACTCCTTGGTGAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198664
TBC1D2 MISSION shRNA Bacterial Glycerol Stock
TBC1 domain family, member 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000192334    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198664.1-304s1c1
Sequence:CCGGCCTAAGAAACTCTGTGGGTATCTCGAGATACCCACAGAGTTTCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191360    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198664.1-1018s1c1
Sequence:CCGGCCTTTGTAACTGAGTCTTAATCTCGAGATTAAGACTCAGTTACAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192113    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198664.1-792s1c1
Sequence:CCGGCCTTCAGAACATCTCCCTAAACTCGAGTTTAGGGAGATGTTCTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198664.3-1817s21c1
Sequence:CCGGTCAGCGAGTACGACGACTATGCTCGAGCATAGTCGTCGTACTCGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198664.3-305s21c1
Sequence:CCGGGTGGGTATTTAAGTAAGTTTGCTCGAGCAAACTTACTTAAATACCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198664.3-800s21c1
Sequence:CCGGAGCATCTGGGCACTGAAATACCTCGAGGTATTTCAGTGCCCAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248869    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198664.3-3374s21c1
Sequence:CCGGCAGGCCTTGGTCACCATTATGCTCGAGCATAATGGTGACCAAGGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198664.3-503s21c1
Sequence:CCGGAGACTCCCAGCCGGGTTATTACTCGAGTAATAACCCGGCTGGGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198664
TBC1D2 MISSION shRNA shRNA Plasmid DNA
TBC1 domain family, member 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000192334    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198664.1-304s1c1
Sequence:CCGGCCTAAGAAACTCTGTGGGTATCTCGAGATACCCACAGAGTTTCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191360    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198664.1-1018s1c1
Sequence:CCGGCCTTTGTAACTGAGTCTTAATCTCGAGATTAAGACTCAGTTACAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192113    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198664.1-792s1c1
Sequence:CCGGCCTTCAGAACATCTCCCTAAACTCGAGTTTAGGGAGATGTTCTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198664.3-1817s21c1
Sequence:CCGGTCAGCGAGTACGACGACTATGCTCGAGCATAGTCGTCGTACTCGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198664.3-305s21c1
Sequence:CCGGGTGGGTATTTAAGTAAGTTTGCTCGAGCAAACTTACTTAAATACCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198664.3-800s21c1
Sequence:CCGGAGCATCTGGGCACTGAAATACCTCGAGGTATTTCAGTGCCCAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248869    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198664.3-3374s21c1
Sequence:CCGGCAGGCCTTGGTCACCATTATGCTCGAGCATAATGGTGACCAAGGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198664.3-503s21c1
Sequence:CCGGAGACTCCCAGCCGGGTTATTACTCGAGTAATAACCCGGCTGGGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198664
TBC1D2 MISSION shRNA Lentiviral Transduction Particles
TBC1 domain family, member 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000192334    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198664.1-304s1c1
Sequence:CCGGCCTAAGAAACTCTGTGGGTATCTCGAGATACCCACAGAGTTTCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191360    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198664.1-1018s1c1
Sequence:CCGGCCTTTGTAACTGAGTCTTAATCTCGAGATTAAGACTCAGTTACAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192113    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198664.1-792s1c1
Sequence:CCGGCCTTCAGAACATCTCCCTAAACTCGAGTTTAGGGAGATGTTCTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198664.3-1817s21c1
Sequence:CCGGTCAGCGAGTACGACGACTATGCTCGAGCATAGTCGTCGTACTCGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198664.3-305s21c1
Sequence:CCGGGTGGGTATTTAAGTAAGTTTGCTCGAGCAAACTTACTTAAATACCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198664.3-800s21c1
Sequence:CCGGAGCATCTGGGCACTGAAATACCTCGAGGTATTTCAGTGCCCAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248869    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198664.3-3374s21c1
Sequence:CCGGCAGGCCTTGGTCACCATTATGCTCGAGCATAATGGTGACCAAGGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198664.3-503s21c1
Sequence:CCGGAGACTCCCAGCCGGGTTATTACTCGAGTAATAACCCGGCTGGGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks