EMAIL THIS PAGE TO A FRIEND

TBC1D2B

TBC1 domain family, member 2B

UniProtKB ID: Q9UPU7, A7MD42, Q8N1F9, Q9NXM0
Gene ID:
Mouse(67016) TBC1 domain family, member 2B
Rat(315880) TBC1 domain family, member 2B
Zebrafish(100330777) TBC1 domain family, member 2B
chicken(415364) TBC1 domain family, member 2B
Horse(100060015) TBC1 domain family, member 2B
domestic cat(101091943) TBC1 domain family, member 2B
dog(488776) TBC1 domain family, member 2B
naked mole-rat(101709524) TBC1 domain family, member 2B
Domestic Rabbit(100337848) TBC1 domain family, member 2B
domestic guinea pig(100729045) TBC1 domain family, member 2B
cow(535927) TBC1 domain family, member 2B
sheep(101114393) TBC1 domain family, member 2B
91 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_194334 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_194334 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_194334 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015079 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015079 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015079 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015079 Rosetta Predictions human pricing
NM_001108175 Rosetta Predictions rat pricing
NM_194334 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015079 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00245004 predicted 2514
2 SASI_Hs01_00245005 predicted 2304
3 SASI_Hs01_00245006 predicted 839
4 SASI_Hs01_00245007 predicted 508
5 SASI_Hs01_00245008 predicted 408
6 SASI_Hs02_00346947 predicted 364
7 SASI_Hs01_00245010 predicted 1613
8 SASI_Hs01_00245011 predicted 2429
9 SASI_Hs02_00346948 predicted 2230
10 SASI_Hs01_00245012 predicted 2348
11 SASI_Hs01_00245009 predicted 2543
12 SASI_Hs01_00245013 predicted 1907
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108175 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00236084 predicted 708
2 SASI_Rn02_00236085 predicted 339
3 SASI_Rn02_00236086 predicted 1402
4 SASI_Rn02_00236087 predicted 2198
5 SASI_Rn02_00236088 predicted 1681
6 SASI_Rn02_00236089 predicted 2077
7 SASI_Rn02_00236090 predicted 390
8 SASI_Rn02_00236091 predicted 918
9 SASI_Rn02_00236092 predicted 1206
10 SASI_Rn02_00236093 predicted 1306
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194334 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00087648 predicted 1624
2 SASI_Mm01_00087649 predicted 411
3 SASI_Mm01_00087651 predicted 2124
4 SASI_Mm01_00087652 predicted 614
5 SASI_Mm01_00087653 predicted 1817
6 SASI_Mm01_00087654 predicted 2907
7 SASI_Mm01_00087655 predicted 551
8 SASI_Mm01_00087656 predicted 2418
9 SASI_Mm01_00087657 predicted 1681
10 SASI_Mm02_00350609 predicted 2999
11 SASI_Mm01_00087650 predicted 874
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_194334
VALIDATED
TBC1D2B MISSION shRNA Bacterial Glycerol Stock
TBC1 domain family, member 2B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106070    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_194334.2-4737s1c1
Sequence:CCGGGCCCAGTGATTGGAAACGAAACTCGAGTTTCGTTTCCAATCACTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_194334.2-1672s1c1
Sequence:CCGGCCAGGTTGAAAGTAAATACTTCTCGAGAAGTATTTACTTTCAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194334.2-2698s1c1
Sequence:CCGGGCAAGATTCGATGTCCATATTCTCGAGAATATGGACATCGAATCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_194334.2-2728s1c1
Sequence:CCGGGCGTTACTTCACTCGGACTATCTCGAGATAGTCCGAGTGAAGTAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_194334.2-897s1c1
Sequence:CCGGGCAGTAAAGGAGTCGCTAGTTCTCGAGAACTAGCGACTCCTTTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_194334
VALIDATED
TBC1D2B MISSION shRNA shRNA Plasmid DNA
TBC1 domain family, member 2B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106070    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_194334.2-4737s1c1
Sequence:CCGGGCCCAGTGATTGGAAACGAAACTCGAGTTTCGTTTCCAATCACTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_194334.2-1672s1c1
Sequence:CCGGCCAGGTTGAAAGTAAATACTTCTCGAGAAGTATTTACTTTCAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194334.2-2698s1c1
Sequence:CCGGGCAAGATTCGATGTCCATATTCTCGAGAATATGGACATCGAATCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_194334.2-2728s1c1
Sequence:CCGGGCGTTACTTCACTCGGACTATCTCGAGATAGTCCGAGTGAAGTAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_194334.2-897s1c1
Sequence:CCGGGCAGTAAAGGAGTCGCTAGTTCTCGAGAACTAGCGACTCCTTTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_194334
VALIDATED
TBC1D2B MISSION shRNA Lentiviral Transduction Particles
TBC1 domain family, member 2B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106070    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_194334.2-4737s1c1
Sequence:CCGGGCCCAGTGATTGGAAACGAAACTCGAGTTTCGTTTCCAATCACTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_194334.2-1672s1c1
Sequence:CCGGCCAGGTTGAAAGTAAATACTTCTCGAGAAGTATTTACTTTCAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194334.2-2698s1c1
Sequence:CCGGGCAAGATTCGATGTCCATATTCTCGAGAATATGGACATCGAATCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_194334.2-2728s1c1
Sequence:CCGGGCGTTACTTCACTCGGACTATCTCGAGATAGTCCGAGTGAAGTAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_194334.2-897s1c1
Sequence:CCGGGCAGTAAAGGAGTCGCTAGTTCTCGAGAACTAGCGACTCCTTTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015079
TBC1D2B MISSION shRNA Bacterial Glycerol Stock
TBC1 domain family, member 2B
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000022129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015079.2-767s1c1
Sequence:CCGGCGCCCTTTGAAAGACATAATTCTCGAGAATTATGTCTTTCAAAGGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015079.2-363s1c1
Sequence:CCGGCCAGAGATAACACTGATTTAACTCGAGTTAAATCAGTGTTATCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015079.2-2383s1c1
Sequence:CCGGCGTTAGTGACATCCTCTTTAACTCGAGTTAAAGAGGATGTCACTAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015079.2-1613s1c1
Sequence:CCGGGCATTTGTTAAACCTCATCTTCTCGAGAAGATGAGGTTTAACAAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015079.2-2497s1c1
Sequence:CCGGGCAAGATTCGATGTCTATATTCTCGAGAATATAGACATCGAATCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015079.5-2665s21c1
Sequence:CCGGCGCTACTTCACTCGCACTATCCTCGAGGATAGTGCGAGTGAAGTAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015079.5-1528s21c1
Sequence:CCGGCTCTCAGCTCTACGAAGAAATCTCGAGATTTCTTCGTAGAGCTGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015079.5-1615s21c1
Sequence:CCGGGAAAGTAAATACCTGATATTGCTCGAGCAATATCAGGTATTTACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015079.5-1122s21c1
Sequence:CCGGATCCCAGTATGACAAGTATTTCTCGAGAAATACTTGTCATACTGGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015079
TBC1D2B MISSION shRNA shRNA Plasmid DNA
TBC1 domain family, member 2B
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000022129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015079.2-767s1c1
Sequence:CCGGCGCCCTTTGAAAGACATAATTCTCGAGAATTATGTCTTTCAAAGGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015079.2-363s1c1
Sequence:CCGGCCAGAGATAACACTGATTTAACTCGAGTTAAATCAGTGTTATCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015079.2-2383s1c1
Sequence:CCGGCGTTAGTGACATCCTCTTTAACTCGAGTTAAAGAGGATGTCACTAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015079.2-1613s1c1
Sequence:CCGGGCATTTGTTAAACCTCATCTTCTCGAGAAGATGAGGTTTAACAAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015079.2-2497s1c1
Sequence:CCGGGCAAGATTCGATGTCTATATTCTCGAGAATATAGACATCGAATCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015079.5-2665s21c1
Sequence:CCGGCGCTACTTCACTCGCACTATCCTCGAGGATAGTGCGAGTGAAGTAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015079.5-1528s21c1
Sequence:CCGGCTCTCAGCTCTACGAAGAAATCTCGAGATTTCTTCGTAGAGCTGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015079.5-1615s21c1
Sequence:CCGGGAAAGTAAATACCTGATATTGCTCGAGCAATATCAGGTATTTACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015079.5-1122s21c1
Sequence:CCGGATCCCAGTATGACAAGTATTTCTCGAGAAATACTTGTCATACTGGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015079
TBC1D2B MISSION shRNA Lentiviral Transduction Particles
TBC1 domain family, member 2B
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000022129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015079.2-767s1c1
Sequence:CCGGCGCCCTTTGAAAGACATAATTCTCGAGAATTATGTCTTTCAAAGGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015079.2-363s1c1
Sequence:CCGGCCAGAGATAACACTGATTTAACTCGAGTTAAATCAGTGTTATCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015079.2-2383s1c1
Sequence:CCGGCGTTAGTGACATCCTCTTTAACTCGAGTTAAAGAGGATGTCACTAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015079.2-1613s1c1
Sequence:CCGGGCATTTGTTAAACCTCATCTTCTCGAGAAGATGAGGTTTAACAAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015079.2-2497s1c1
Sequence:CCGGGCAAGATTCGATGTCTATATTCTCGAGAATATAGACATCGAATCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015079.5-2665s21c1
Sequence:CCGGCGCTACTTCACTCGCACTATCCTCGAGGATAGTGCGAGTGAAGTAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015079.5-1528s21c1
Sequence:CCGGCTCTCAGCTCTACGAAGAAATCTCGAGATTTCTTCGTAGAGCTGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015079.5-1615s21c1
Sequence:CCGGGAAAGTAAATACCTGATATTGCTCGAGCAATATCAGGTATTTACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015079.5-1122s21c1
Sequence:CCGGATCCCAGTATGACAAGTATTTCTCGAGAAATACTTGTCATACTGGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks