EMAIL THIS PAGE TO A FRIEND

TBC1D30

TBC1 domain family, member 30

UniProtKB ID: Q9Y2I9, B3KP01, B9A6M9, E7EMW4, F5GYJ9
Gene ID:
Mouse(74694) TBC1 domain family, member 30
Rat(299824) TBC1 domain family, member 30
Zebrafish(569334) TBC1 domain family, member 30
chicken(417830) TBC1 domain family, member 30
Horse(100057098) TBC1 domain family, member 30
domestic cat(101088590) TBC1 domain family, member 30
dog(481147) TBC1 domain family, member 30
cow(541051) TBC1 domain family, member 30
sheep(101109787) TBC1 domain family, member 30
domestic guinea pig(100731130) TBC1 domain family, member 30
Domestic Rabbit(100359281) TBC1 domain family, member 30
219 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029057 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029057 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029057 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001716833 Rosetta Predictions human pricing
XM_037557 Rosetta Predictions human pricing
XM_939476 Rosetta Predictions human pricing
XM_001081058 Rosetta Predictions rat pricing
XM_235191 Rosetta Predictions rat pricing
XM_001481269 Rosetta Predictions mouse pricing
XM_137322 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001716833 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00413265 predicted 1830
2 SASI_Hs02_00413266 predicted 853
3 SASI_Hs02_00413267 predicted 1588
4 SASI_Hs02_00413268 predicted 643
5 SASI_Hs02_00413269 predicted 2148
6 SASI_Hs02_00413270 predicted 653
7 SASI_Hs02_00413271 predicted 1120
8 SASI_Hs02_00413272 predicted 700
9 SASI_Hs02_00413273 predicted 1035
10 SASI_Hs02_00413274 predicted 2178
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_037557 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00252839 predicted 1836
2 SASI_Hs02_00478663 predicted 850
3 SASI_Hs01_00252841 predicted 1588
4 SASI_Hs01_00252843 predicted 642
5 SASI_Hs01_00252844 predicted 2151
6 SASI_Hs01_00252845 predicted 657
7 SASI_Hs02_00478664 predicted 1118
8 SASI_Hs01_00252846 predicted 698
9 SASI_Hs01_00252847 predicted 1036
10 SASI_Hs01_00252848 predicted 2181
11 SASI_Hs01_00252840 predicted 860
12 SASI_Hs01_00252842 predicted 1976
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_939476 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00483637 predicted 1833
2 SASI_Hs02_00483638 predicted 850
3 SASI_Hs02_00483639 predicted 1580
4 SASI_Hs02_00483640 predicted 2153
5 SASI_Hs02_00483641 predicted 658
6 SASI_Hs02_00483642 predicted 1111
7 SASI_Hs02_00483643 predicted 702
8 SASI_Hs02_00483644 predicted 1035
9 SASI_Hs02_00483645 predicted 2179
10 SASI_Hs02_00483646 predicted 795
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081058 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00370394 predicted 832
2 SASI_Rn02_00370395 predicted 1800
3 SASI_Rn02_00370396 predicted 657
4 SASI_Rn02_00370397 predicted 696
5 SASI_Rn02_00370398 predicted 665
6 SASI_Rn02_00370399 predicted 1731
7 SASI_Rn02_00370400 predicted 1294
8 SASI_Rn02_00370401 predicted 1564
9 SASI_Rn02_00370402 predicted 976
10 SASI_Rn02_00370403 predicted 1323
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_235191 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00389075 predicted 832
2 SASI_Rn02_00389076 predicted 650
3 SASI_Rn02_00389077 predicted 1305
4 SASI_Rn02_00389078 predicted 701
5 SASI_Rn02_00389079 predicted 661
6 SASI_Rn02_00389080 predicted 1297
7 SASI_Rn02_00389081 predicted 1565
8 SASI_Rn02_00389082 predicted 982
9 SASI_Rn02_00389083 predicted 1060
10 SASI_Rn02_00389084 predicted 1080
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001481269 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00423266 predicted 1518
2 SASI_Mm02_00423267 predicted 1221
3 SASI_Mm02_00423268 predicted 1084
4 SASI_Mm02_00423269 predicted 1051
5 SASI_Mm02_00423270 predicted 2742
6 SASI_Mm02_00423271 predicted 1716
7 SASI_Mm02_00423272 predicted 2806
8 SASI_Mm02_00423273 predicted 2118
9 SASI_Mm02_00423274 predicted 1179
10 SASI_Mm02_00423275 predicted 899
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_137322 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00255556 predicted 1520
2 SASI_Mm01_00255557 predicted 1222
3 SASI_Mm01_00255558 predicted 1092
4 SASI_Mm01_00255560 predicted 2735
5 SASI_Mm01_00255561 predicted 1711
6 SASI_Mm02_00424775 predicted 2808
7 SASI_Mm01_00255562 predicted 2117
8 SASI_Mm01_00255564 predicted 1184
9 SASI_Mm02_00424776 predicted 898
10 SASI_Mm02_00424777 predicted 1609
11 SASI_Mm01_00255559 predicted 790
12 SASI_Mm01_00255563 predicted 1915
13 SASI_Mm01_00255565 predicted 773
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029057
TBC1D30 MISSION shRNA Bacterial Glycerol Stock
TBC1 domain family, member 30
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000341751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029057.1-860s21c1
Sequence:CCGGGGTACTAAAGCGGGTGCTATTCTCGAGAATAGCACCCGCTTTAGTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029057.1-680s21c1
Sequence:CCGGGTTGACCTTGGCGGATCATTACTCGAGTAATGATCCGCCAAGGTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029057.1-1826s21c1
Sequence:CCGGGCGGCAGTACTCCCGAATTAACTCGAGTTAATTCGGGAGTACTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341753    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029057.1-2870s21c1
Sequence:CCGGGGATTCTGGTGACTAAGTAAACTCGAGTTTACTTAGTCACCAGAATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029057.1-1505s21c1
Sequence:CCGGACCGTTTCCAGCCACGATTAACTCGAGTTAATCGTGGCTGGAAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029057
TBC1D30 MISSION shRNA shRNA Plasmid DNA
TBC1 domain family, member 30
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000341751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029057.1-860s21c1
Sequence:CCGGGGTACTAAAGCGGGTGCTATTCTCGAGAATAGCACCCGCTTTAGTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029057.1-680s21c1
Sequence:CCGGGTTGACCTTGGCGGATCATTACTCGAGTAATGATCCGCCAAGGTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029057.1-1826s21c1
Sequence:CCGGGCGGCAGTACTCCCGAATTAACTCGAGTTAATTCGGGAGTACTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341753    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029057.1-2870s21c1
Sequence:CCGGGGATTCTGGTGACTAAGTAAACTCGAGTTTACTTAGTCACCAGAATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029057.1-1505s21c1
Sequence:CCGGACCGTTTCCAGCCACGATTAACTCGAGTTAATCGTGGCTGGAAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029057
TBC1D30 MISSION shRNA Lentiviral Transduction Particles
TBC1 domain family, member 30
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000341751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029057.1-860s21c1
Sequence:CCGGGGTACTAAAGCGGGTGCTATTCTCGAGAATAGCACCCGCTTTAGTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029057.1-680s21c1
Sequence:CCGGGTTGACCTTGGCGGATCATTACTCGAGTAATGATCCGCCAAGGTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029057.1-1826s21c1
Sequence:CCGGGCGGCAGTACTCCCGAATTAACTCGAGTTAATTCGGGAGTACTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341753    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029057.1-2870s21c1
Sequence:CCGGGGATTCTGGTGACTAAGTAAACTCGAGTTTACTTAGTCACCAGAATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029057.1-1505s21c1
Sequence:CCGGACCGTTTCCAGCCACGATTAACTCGAGTTAATCGTGGCTGGAAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks