EMAIL THIS PAGE TO A FRIEND

TBC1D31

TBC1 domain family, member 31

Synonyms: Gm85 WDR67
Gene ID:
Mouse(210544) TBC1 domain family, member 31
Rat(299949) TBC1 domain family, member 31
Zebrafish(563134) TBC1 domain family, member 31
168 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145647 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145647 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145647 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081396 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081396 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081396 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145647 Rosetta Predictions human pricing
NM_001134842 Rosetta Predictions rat pricing
NM_001081396 Rosetta Predictions mouse pricing
XM_128124 Rosetta Predictions mouse pricing
XM_896696 Rosetta Predictions mouse pricing
XM_896723 Rosetta Predictions mouse pricing
XM_896734 Rosetta Predictions mouse pricing
XM_896743 Rosetta Predictions mouse pricing
XM_896769 Rosetta Predictions mouse pricing
XM_977372 Rosetta Predictions mouse pricing
XM_977403 Rosetta Predictions mouse pricing
XM_977478 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145647 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00049874 predicted 355
2 SASI_Hs02_00365264 predicted 2764
3 SASI_Hs01_00049875 predicted 1140
4 SASI_Hs01_00049877 predicted 1149
5 SASI_Hs01_00049878 predicted 2778
6 SASI_Hs02_00365265 predicted 536
7 SASI_Hs01_00049879 predicted 3057
8 SASI_Hs01_00049880 predicted 1515
9 SASI_Hs01_00049881 predicted 504
10 SASI_Hs01_00049882 predicted 452
11 SASI_Hs01_00049876 predicted 2482
12 SASI_Hs01_00049883 predicted 3025
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134842 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00258684 predicted 1770
2 SASI_Rn02_00258685 predicted 2741
3 SASI_Rn02_00258686 predicted 1993
4 SASI_Rn02_00258687 predicted 997
5 SASI_Rn02_00258688 predicted 2524
6 SASI_Rn02_00258689 predicted 957
7 SASI_Rn02_00258690 predicted 3079
8 SASI_Rn02_00258691 predicted 3092
9 SASI_Rn02_00258692 predicted 2162
10 SASI_Rn02_00258693 predicted 343
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081396 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00297991 predicted 1804
2 SASI_Mm02_00297992 predicted 2963
3 SASI_Mm02_00297993 predicted 3107
4 SASI_Mm02_00297994 predicted 1523
5 SASI_Mm02_00297995 predicted 2022
6 SASI_Mm02_00297996 predicted 3003
7 SASI_Mm02_00297997 predicted 1845
8 SASI_Mm02_00297998 predicted 744
9 SASI_Mm02_00297999 predicted 1444
10 SASI_Mm02_00298000 predicted 1709
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_128124 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00267650 predicted 1116
2 SASI_Mm01_00267651 predicted 1727
3 SASI_Mm01_00267652 predicted 1809
4 SASI_Mm01_00267653 predicted 1526
5 SASI_Mm01_00267654 predicted 1078
6 SASI_Mm01_00267655 predicted 2027
7 SASI_Mm01_00267656 predicted 1172
8 SASI_Mm01_00267657 predicted 991
9 SASI_Mm01_00267658 predicted 1850
10 SASI_Mm01_00267659 predicted 1449
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896696 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00274325 predicted 1119
2 SASI_Mm01_00274326 predicted 1730
3 SASI_Mm01_00274327 predicted 1809
4 SASI_Mm01_00274328 predicted 1524
5 SASI_Mm01_00274329 predicted 1073
6 SASI_Mm01_00274330 predicted 2033
7 SASI_Mm01_00274331 predicted 1171
8 SASI_Mm01_00274332 predicted 995
9 SASI_Mm01_00274333 predicted 1851
10 SASI_Mm01_00274334 predicted 1455
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896723 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00206096 predicted 1191
2 SASI_Mm01_00206097 predicted 1800
3 SASI_Mm01_00206098 predicted 1879
4 SASI_Mm01_00206099 predicted 1606
5 SASI_Mm01_00206100 predicted 1147
6 SASI_Mm01_00206101 predicted 2102
7 SASI_Mm01_00206102 predicted 1250
8 SASI_Mm01_00206103 predicted 1067
9 SASI_Mm01_00206104 predicted 1927
10 SASI_Mm01_00206105 predicted 1526
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896734 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00234699 predicted 1118
2 SASI_Mm01_00234700 predicted 1732
3 SASI_Mm01_00234701 predicted 1811
4 SASI_Mm01_00234702 predicted 1527
5 SASI_Mm01_00234703 predicted 1079
6 SASI_Mm01_00234704 predicted 2026
7 SASI_Mm01_00234705 predicted 1165
8 SASI_Mm01_00234706 predicted 993
9 SASI_Mm01_00234707 predicted 1848
10 SASI_Mm01_00234708 predicted 1452
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896743 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00233459 predicted 930
2 SASI_Mm01_00233460 predicted 1545
3 SASI_Mm01_00233461 predicted 1620
4 SASI_Mm01_00233462 predicted 1342
5 SASI_Mm01_00233463 predicted 888
6 SASI_Mm01_00233464 predicted 1850
7 SASI_Mm01_00233465 predicted 985
8 SASI_Mm01_00233466 predicted 812
9 SASI_Mm01_00233467 predicted 1666
10 SASI_Mm01_00233468 predicted 1274
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896769 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00255546 predicted 932
2 SASI_Mm01_00255547 predicted 1541
3 SASI_Mm01_00255548 predicted 1618
4 SASI_Mm01_00255549 predicted 1341
5 SASI_Mm01_00255550 predicted 892
6 SASI_Mm01_00255551 predicted 1848
7 SASI_Mm01_00255552 predicted 990
8 SASI_Mm01_00255553 predicted 804
9 SASI_Mm01_00255554 predicted 1667
10 SASI_Mm01_00255555 predicted 1265
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_977372 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00283398 predicted 1132
2 SASI_Mm01_00283399 predicted 1748
3 SASI_Mm01_00283400 predicted 1829
4 SASI_Mm01_00283401 predicted 1550
5 SASI_Mm01_00283402 predicted 1097
6 SASI_Mm01_00283403 predicted 2044
7 SASI_Mm01_00283404 predicted 1189
8 SASI_Mm01_00283405 predicted 1013
9 SASI_Mm01_00283406 predicted 1870
10 SASI_Mm01_00283407 predicted 1477
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_977403 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00251900 predicted 1118
2 SASI_Mm01_00251901 predicted 1733
3 SASI_Mm01_00251902 predicted 1809
4 SASI_Mm01_00251903 predicted 1526
5 SASI_Mm01_00251904 predicted 1080
6 SASI_Mm01_00251905 predicted 2029
7 SASI_Mm01_00251906 predicted 1169
8 SASI_Mm01_00251907 predicted 991
9 SASI_Mm01_00251908 predicted 1856
10 SASI_Mm01_00251909 predicted 1458
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_977478 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00274715 predicted 1121
2 SASI_Mm01_00274716 predicted 1726
3 SASI_Mm01_00274717 predicted 1811
4 SASI_Mm01_00274718 predicted 1529
5 SASI_Mm01_00274719 predicted 1078
6 SASI_Mm01_00274720 predicted 2024
7 SASI_Mm01_00274721 predicted 1175
8 SASI_Mm01_00274722 predicted 987
9 SASI_Mm01_00274723 predicted 1851
10 SASI_Mm01_00274724 predicted 1448
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145647
VALIDATED
TBC1D31 MISSION shRNA Bacterial Glycerol Stock
TBC1 domain family, member 31
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000276274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_145647.2-1044s21c1
Sequence:CCGGACGGTACATTGCATCTATTATCTCGAGATAATAGATGCAATGTACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276275    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145647.2-3312s21c1
Sequence:CCGGGGTCGAGAGAGAGACCTATTTCTCGAGAAATAGGTCTCTCTCTCGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_145647.2-389s21c1
Sequence:CCGGTTGTGGCATTAGCTGATTATTCTCGAGAATAATCAGCTAATGCCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_145647.2-969s21c1
Sequence:CCGGGCAGACTTGTAAACTTCTCTTCTCGAGAAGAGAAGTTTACAAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_145647.1-1353s1c1
Sequence:CCGGGCTATGGTGAATATCCAACAACTCGAGTTGTTGGATATTCACCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_145647.1-970s1c1
Sequence:CCGGGCAGACTTGTAAACTTCTCTTCTCGAGAAGAGAAGTTTACAAGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144259    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145647.1-389s1c1
Sequence:CCGGCTTGTGGCATTAGCTGATTATCTCGAGATAATCAGCTAATGCCACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145647.1-1987s1c1
Sequence:CCGGCCATCGGAATAACCTGGATATCTCGAGATATCCAGGTTATTCCGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143942    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145647.1-3195s1c1
Sequence:CCGGCGGGACAGAATCTTATTAAGACTCGAGTCTTAATAAGATTCTGTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_145647.1-1427s1c1
Sequence:CCGGGCGTTTAGTACCCTCATAGATCTCGAGATCTATGAGGGTACTAAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142586    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145647.1-3016s1c1
Sequence:CCGGGCAAGAGATAAATGCGGCTGTCTCGAGACAGCCGCATTTATCTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145647.1-3017s1c1
Sequence:CCGGCAAGAGATAAATGCGGCTGTACTCGAGTACAGCCGCATTTATCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145647
VALIDATED
TBC1D31 MISSION shRNA shRNA Plasmid DNA
TBC1 domain family, member 31
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000276274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_145647.2-1044s21c1
Sequence:CCGGACGGTACATTGCATCTATTATCTCGAGATAATAGATGCAATGTACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276275    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145647.2-3312s21c1
Sequence:CCGGGGTCGAGAGAGAGACCTATTTCTCGAGAAATAGGTCTCTCTCTCGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_145647.2-389s21c1
Sequence:CCGGTTGTGGCATTAGCTGATTATTCTCGAGAATAATCAGCTAATGCCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_145647.2-969s21c1
Sequence:CCGGGCAGACTTGTAAACTTCTCTTCTCGAGAAGAGAAGTTTACAAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_145647.1-1353s1c1
Sequence:CCGGGCTATGGTGAATATCCAACAACTCGAGTTGTTGGATATTCACCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_145647.1-970s1c1
Sequence:CCGGGCAGACTTGTAAACTTCTCTTCTCGAGAAGAGAAGTTTACAAGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144259    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145647.1-389s1c1
Sequence:CCGGCTTGTGGCATTAGCTGATTATCTCGAGATAATCAGCTAATGCCACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145647.1-1987s1c1
Sequence:CCGGCCATCGGAATAACCTGGATATCTCGAGATATCCAGGTTATTCCGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143942    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145647.1-3195s1c1
Sequence:CCGGCGGGACAGAATCTTATTAAGACTCGAGTCTTAATAAGATTCTGTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_145647.1-1427s1c1
Sequence:CCGGGCGTTTAGTACCCTCATAGATCTCGAGATCTATGAGGGTACTAAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142586    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145647.1-3016s1c1
Sequence:CCGGGCAAGAGATAAATGCGGCTGTCTCGAGACAGCCGCATTTATCTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145647.1-3017s1c1
Sequence:CCGGCAAGAGATAAATGCGGCTGTACTCGAGTACAGCCGCATTTATCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145647
VALIDATED
TBC1D31 MISSION shRNA Lentiviral Transduction Particles
TBC1 domain family, member 31
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000276274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_145647.2-1044s21c1
Sequence:CCGGACGGTACATTGCATCTATTATCTCGAGATAATAGATGCAATGTACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276275    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145647.2-3312s21c1
Sequence:CCGGGGTCGAGAGAGAGACCTATTTCTCGAGAAATAGGTCTCTCTCTCGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_145647.2-389s21c1
Sequence:CCGGTTGTGGCATTAGCTGATTATTCTCGAGAATAATCAGCTAATGCCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_145647.2-969s21c1
Sequence:CCGGGCAGACTTGTAAACTTCTCTTCTCGAGAAGAGAAGTTTACAAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_145647.1-1353s1c1
Sequence:CCGGGCTATGGTGAATATCCAACAACTCGAGTTGTTGGATATTCACCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_145647.1-970s1c1
Sequence:CCGGGCAGACTTGTAAACTTCTCTTCTCGAGAAGAGAAGTTTACAAGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144259    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145647.1-389s1c1
Sequence:CCGGCTTGTGGCATTAGCTGATTATCTCGAGATAATCAGCTAATGCCACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145647.1-1987s1c1
Sequence:CCGGCCATCGGAATAACCTGGATATCTCGAGATATCCAGGTTATTCCGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143942    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145647.1-3195s1c1
Sequence:CCGGCGGGACAGAATCTTATTAAGACTCGAGTCTTAATAAGATTCTGTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_145647.1-1427s1c1
Sequence:CCGGGCGTTTAGTACCCTCATAGATCTCGAGATCTATGAGGGTACTAAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142586    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145647.1-3016s1c1
Sequence:CCGGGCAAGAGATAAATGCGGCTGTCTCGAGACAGCCGCATTTATCTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145647.1-3017s1c1
Sequence:CCGGCAAGAGATAAATGCGGCTGTACTCGAGTACAGCCGCATTTATCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081396
VALIDATED
TBC1D31 MISSION shRNA Bacterial Glycerol Stock
TBC1 domain family, member 31
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081396.1-1792s21c1
Sequence:CCGGACTTCATAGATCGTGATATAACTCGAGTTATATCACGATCTATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244611    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081396.1-3310s21c1
Sequence:CCGGTTTACCATTAAACAATCAGAGCTCGAGCTCTGATTGTTTAATGGTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081396.1-1328s21c1
Sequence:CCGGTGAATTGTCAGAAGGATTAAACTCGAGTTTAATCCTTCTGACAATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081396.1-415s21c1
Sequence:CCGGTTGTGGCGTTAGCTGATTATTCTCGAGAATAATCAGCTAACGCCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081396.1-1070s21c1
Sequence:CCGGTCGGTACATAGCATCCATTATCTCGAGATAATGGATGCTATGTACCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081396
VALIDATED
TBC1D31 MISSION shRNA shRNA Plasmid DNA
TBC1 domain family, member 31
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081396.1-1792s21c1
Sequence:CCGGACTTCATAGATCGTGATATAACTCGAGTTATATCACGATCTATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244611    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081396.1-3310s21c1
Sequence:CCGGTTTACCATTAAACAATCAGAGCTCGAGCTCTGATTGTTTAATGGTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081396.1-1328s21c1
Sequence:CCGGTGAATTGTCAGAAGGATTAAACTCGAGTTTAATCCTTCTGACAATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081396.1-415s21c1
Sequence:CCGGTTGTGGCGTTAGCTGATTATTCTCGAGAATAATCAGCTAACGCCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081396.1-1070s21c1
Sequence:CCGGTCGGTACATAGCATCCATTATCTCGAGATAATGGATGCTATGTACCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081396
VALIDATED
TBC1D31 MISSION shRNA Lentiviral Transduction Particles
TBC1 domain family, member 31
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081396.1-1792s21c1
Sequence:CCGGACTTCATAGATCGTGATATAACTCGAGTTATATCACGATCTATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244611    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081396.1-3310s21c1
Sequence:CCGGTTTACCATTAAACAATCAGAGCTCGAGCTCTGATTGTTTAATGGTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081396.1-1328s21c1
Sequence:CCGGTGAATTGTCAGAAGGATTAAACTCGAGTTTAATCCTTCTGACAATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081396.1-415s21c1
Sequence:CCGGTTGTGGCGTTAGCTGATTATTCTCGAGAATAATCAGCTAACGCCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081396.1-1070s21c1
Sequence:CCGGTCGGTACATAGCATCCATTATCTCGAGATAATGGATGCTATGTACCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks