EMAIL THIS PAGE TO A FRIEND

TBC1D32

TBC1 domain family, member 32

Synonyms: BROMI C6orf170 C6orf171 bA301B7.2 bA57L9.1 dJ310J6.1
Gene ID:
Mouse(544696) TBC1 domain family, member 32
Rat(100359595) TBC1 domain family, member 32
Zebrafish(566474) TBC1 domain family, member 32
cow(518886) TBC1 domain family, member 32
73 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152730 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152730 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152730 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033385 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033385 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033385 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152730 Rosetta Predictions human pricing
NM_001033385 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152730 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00044624 predicted 3023
2 SASI_Hs01_00044625 predicted 1022
3 SASI_Hs01_00044627 predicted 852
4 SASI_Hs02_00366638 predicted 630
5 SASI_Hs01_00044628 predicted 1371
6 SASI_Hs02_00366639 predicted 463
7 SASI_Hs01_00044633 predicted 2505
8 SASI_Hs02_00366640 predicted 3838
9 SASI_Hs02_00366641 predicted 740
10 SASI_Hs02_00366642 predicted 1155
11 SASI_Hs01_00044626 predicted 1548
12 SASI_Hs01_00044629 predicted 1197
13 SASI_Hs01_00044630 predicted 2740
14 SASI_Hs01_00044631 predicted 1553
15 SASI_Hs01_00044632 predicted 2304
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033385 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00288687 predicted 1853
2 SASI_Mm02_00288688 predicted 3691
3 SASI_Mm01_00054282 predicted 2523
4 SASI_Mm01_00054286 predicted 2489
5 SASI_Mm02_00288689 predicted 317
6 SASI_Mm01_00054287 predicted 2306
7 SASI_Mm02_00288690 predicted 718
8 SASI_Mm02_00288691 predicted 1674
9 SASI_Mm02_00288692 predicted 2477
10 SASI_Mm02_00288693 predicted 2631
11 SASI_Mm01_00054278 predicted 277
12 SASI_Mm01_00054279 predicted 716
13 SASI_Mm01_00054280 predicted 920
14 SASI_Mm01_00054281 predicted 413
15 SASI_Mm01_00054283 predicted 957
16 SASI_Mm01_00054284 predicted 431
17 SASI_Mm01_00054285 predicted 887
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152730
VALIDATED
TBC1D32 MISSION shRNA Bacterial Glycerol Stock
TBC1 domain family, member 32
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152730.3-1042s1c1
Sequence:CCGGCAAAGCCATGTTGTCTCACAACTCGAGTTGTGAGACAACATGGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_152730.3-2147s1c1
Sequence:CCGGGAACAGGTGCTATCAATGAATCTCGAGATTCATTGATAGCACCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_152730.3-1576s1c1
Sequence:CCGGGAATGTGCAGTGGAATGCTTACTCGAGTAAGCATTCCACTGCACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149261    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152730.3-3168s1c1
Sequence:CCGGGCATTGTGAGAGATTCCTGAACTCGAGTTCAGGAATCTCTCACAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152730.3-2740s1c1
Sequence:CCGGCCATATCCTTGGCCAATGTTTCTCGAGAAACATTGGCCAAGGATATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_152730.3-898s1c1
Sequence:CCGGCCTAATATGACTCGCTTACTTCTCGAGAAGTAAGCGAGTCATATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152730.4-2935s21c1
Sequence:CCGGTGAAAGCCAAACCTGATATAACTCGAGTTATATCAGGTTTGGCTTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152730.4-1741s21c1
Sequence:CCGGCTGTAGAAGAAGGGCTTATTTCTCGAGAAATAAGCCCTTCTTCTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413519    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152730.4-3844s21c1
Sequence:CCGGTCATGAGACACACGGTTTAAACTCGAGTTTAAACCGTGTGTCTCATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152730.4-1179s21c1
Sequence:CCGGAGACTTCTTGAAACGAAATATCTCGAGATATTTCGTTTCAAGAAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152730.4-1801s21c1
Sequence:CCGGGTCCTACAGGTGCTCATATAACTCGAGTTATATGAGCACCTGTAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152730
VALIDATED
TBC1D32 MISSION shRNA shRNA Plasmid DNA
TBC1 domain family, member 32
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152730.3-1042s1c1
Sequence:CCGGCAAAGCCATGTTGTCTCACAACTCGAGTTGTGAGACAACATGGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_152730.3-2147s1c1
Sequence:CCGGGAACAGGTGCTATCAATGAATCTCGAGATTCATTGATAGCACCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_152730.3-1576s1c1
Sequence:CCGGGAATGTGCAGTGGAATGCTTACTCGAGTAAGCATTCCACTGCACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149261    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152730.3-3168s1c1
Sequence:CCGGGCATTGTGAGAGATTCCTGAACTCGAGTTCAGGAATCTCTCACAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152730.3-2740s1c1
Sequence:CCGGCCATATCCTTGGCCAATGTTTCTCGAGAAACATTGGCCAAGGATATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_152730.3-898s1c1
Sequence:CCGGCCTAATATGACTCGCTTACTTCTCGAGAAGTAAGCGAGTCATATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152730.4-2935s21c1
Sequence:CCGGTGAAAGCCAAACCTGATATAACTCGAGTTATATCAGGTTTGGCTTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152730.4-1741s21c1
Sequence:CCGGCTGTAGAAGAAGGGCTTATTTCTCGAGAAATAAGCCCTTCTTCTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413519    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152730.4-3844s21c1
Sequence:CCGGTCATGAGACACACGGTTTAAACTCGAGTTTAAACCGTGTGTCTCATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152730.4-1179s21c1
Sequence:CCGGAGACTTCTTGAAACGAAATATCTCGAGATATTTCGTTTCAAGAAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152730.4-1801s21c1
Sequence:CCGGGTCCTACAGGTGCTCATATAACTCGAGTTATATGAGCACCTGTAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152730
VALIDATED
TBC1D32 MISSION shRNA Lentiviral Transduction Particles
TBC1 domain family, member 32
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152730.3-1042s1c1
Sequence:CCGGCAAAGCCATGTTGTCTCACAACTCGAGTTGTGAGACAACATGGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_152730.3-2147s1c1
Sequence:CCGGGAACAGGTGCTATCAATGAATCTCGAGATTCATTGATAGCACCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_152730.3-1576s1c1
Sequence:CCGGGAATGTGCAGTGGAATGCTTACTCGAGTAAGCATTCCACTGCACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149261    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152730.3-3168s1c1
Sequence:CCGGGCATTGTGAGAGATTCCTGAACTCGAGTTCAGGAATCTCTCACAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152730.3-2740s1c1
Sequence:CCGGCCATATCCTTGGCCAATGTTTCTCGAGAAACATTGGCCAAGGATATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_152730.3-898s1c1
Sequence:CCGGCCTAATATGACTCGCTTACTTCTCGAGAAGTAAGCGAGTCATATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152730.4-2935s21c1
Sequence:CCGGTGAAAGCCAAACCTGATATAACTCGAGTTATATCAGGTTTGGCTTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152730.4-1741s21c1
Sequence:CCGGCTGTAGAAGAAGGGCTTATTTCTCGAGAAATAAGCCCTTCTTCTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413519    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152730.4-3844s21c1
Sequence:CCGGTCATGAGACACACGGTTTAAACTCGAGTTTAAACCGTGTGTCTCATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152730.4-1179s21c1
Sequence:CCGGAGACTTCTTGAAACGAAATATCTCGAGATATTTCGTTTCAAGAAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152730.4-1801s21c1
Sequence:CCGGGTCCTACAGGTGCTCATATAACTCGAGTTATATGAGCACCTGTAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033385
TBC1D32 MISSION shRNA Bacterial Glycerol Stock
TBC1 domain family, member 32
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000269190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033385.3-2922s21c1
Sequence:CCGGTCCACGAAGTGCTGATCTAAACTCGAGTTTAGATCAGCACTTCGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269295    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033385.3-5994s21c1
Sequence:CCGGCAATACCCAACAAGCTATTAACTCGAGTTAATAGCTTGTTGGGTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033385.3-771s21c1
Sequence:CCGGTACCCTCTCACCGTTACATATCTCGAGATATGTAACGGTGAGAGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033385.3-2782s21c1
Sequence:CCGGCATGTTCTCGTAAGGATTAATCTCGAGATTAATCCTTACGAGAACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033385.3-2519s21c1
Sequence:CCGGCCACATGCATCATCGATATAACTCGAGTTATATCGATGATGCATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033385
TBC1D32 MISSION shRNA shRNA Plasmid DNA
TBC1 domain family, member 32
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000269190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033385.3-2922s21c1
Sequence:CCGGTCCACGAAGTGCTGATCTAAACTCGAGTTTAGATCAGCACTTCGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269295    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033385.3-5994s21c1
Sequence:CCGGCAATACCCAACAAGCTATTAACTCGAGTTAATAGCTTGTTGGGTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033385.3-771s21c1
Sequence:CCGGTACCCTCTCACCGTTACATATCTCGAGATATGTAACGGTGAGAGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033385.3-2782s21c1
Sequence:CCGGCATGTTCTCGTAAGGATTAATCTCGAGATTAATCCTTACGAGAACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033385.3-2519s21c1
Sequence:CCGGCCACATGCATCATCGATATAACTCGAGTTATATCGATGATGCATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033385
TBC1D32 MISSION shRNA Lentiviral Transduction Particles
TBC1 domain family, member 32
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000269190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033385.3-2922s21c1
Sequence:CCGGTCCACGAAGTGCTGATCTAAACTCGAGTTTAGATCAGCACTTCGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269295    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033385.3-5994s21c1
Sequence:CCGGCAATACCCAACAAGCTATTAACTCGAGTTAATAGCTTGTTGGGTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033385.3-771s21c1
Sequence:CCGGTACCCTCTCACCGTTACATATCTCGAGATATGTAACGGTGAGAGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033385.3-2782s21c1
Sequence:CCGGCATGTTCTCGTAAGGATTAATCTCGAGATTAATCCTTACGAGAACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033385.3-2519s21c1
Sequence:CCGGCCACATGCATCATCGATATAACTCGAGTTATATCGATGATGCATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks