EMAIL THIS PAGE TO A FRIEND

TBC1D3

TBC1 domain family, member 3

Synonyms: PRC17 TBC1D3A TBC1D3F
Species: Human TBC1D3(729873)
UniProtKB ID: Q8IZP1, A6NGX2, Q9H0B9, Q9UDD4
Gene ID:
31 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001123391 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001123391 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001123391 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001123391 Rosetta Predictions human pricing
XM_001134185 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001123391 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00327918 predicted 1049
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001134185 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00391941 predicted 2990
2 SASI_Hs02_00391942 predicted 2491
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001123391
TBC1D3 MISSION shRNA Bacterial Glycerol Stock
TBC1 domain family, member 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123391.1-1054s21c1
Sequence:CCGGGATAACAAGAATCGCCTTTAACTCGAGTTAAAGGCGATTCTTGTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123391.1-954s21c1
Sequence:CCGGTAGGCTGCCTCATCCGGATATCTCGAGATATCCGGATGAGGCAGCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123391.1-609s21c1
Sequence:CCGGGGACATTAAGGAAGCATATATCTCGAGATATATGCTTCCTTAATGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255682    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001123391.1-1834s21c1
Sequence:CCGGGGATAATTTCCCTAGGCTTAACTCGAGTTAAGCCTAGGGAAATTATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123391.1-1129s21c1
Sequence:CCGGTTGCAACCGGTTCGTTGATACCTCGAGGTATCAACGAACCGGTTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001123391
TBC1D3 MISSION shRNA shRNA Plasmid DNA
TBC1 domain family, member 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123391.1-1054s21c1
Sequence:CCGGGATAACAAGAATCGCCTTTAACTCGAGTTAAAGGCGATTCTTGTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123391.1-954s21c1
Sequence:CCGGTAGGCTGCCTCATCCGGATATCTCGAGATATCCGGATGAGGCAGCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123391.1-609s21c1
Sequence:CCGGGGACATTAAGGAAGCATATATCTCGAGATATATGCTTCCTTAATGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255682    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001123391.1-1834s21c1
Sequence:CCGGGGATAATTTCCCTAGGCTTAACTCGAGTTAAGCCTAGGGAAATTATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123391.1-1129s21c1
Sequence:CCGGTTGCAACCGGTTCGTTGATACCTCGAGGTATCAACGAACCGGTTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001123391
TBC1D3 MISSION shRNA Lentiviral Transduction Particles
TBC1 domain family, member 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123391.1-1054s21c1
Sequence:CCGGGATAACAAGAATCGCCTTTAACTCGAGTTAAAGGCGATTCTTGTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123391.1-954s21c1
Sequence:CCGGTAGGCTGCCTCATCCGGATATCTCGAGATATCCGGATGAGGCAGCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123391.1-609s21c1
Sequence:CCGGGGACATTAAGGAAGCATATATCTCGAGATATATGCTTCCTTAATGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255682    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001123391.1-1834s21c1
Sequence:CCGGGGATAATTTCCCTAGGCTTAACTCGAGTTAAGCCTAGGGAAATTATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123391.1-1129s21c1
Sequence:CCGGTTGCAACCGGTTCGTTGATACCTCGAGGTATCAACGAACCGGTTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks