EMAIL THIS PAGE TO A FRIEND

TBC1D3B

TBC1 domain family, member 3B

Synonyms: PRC17 TBC1D3I
Species: Human TBC1D3B(414059)
UniProtKB ID: A6NDS4, A8K892
Gene ID:
Human(414059) Summary: This gene encodes a protein that is similar to TBC1 domain family, member 3. This protein contains a TBC (Tre-2, Bub2p, and Cdc16p) domain, which is found in proteins involved in RAB GTPase signaling and vesicle trafficking. There are multiple copies of this gene located within a cluster of chemokine genes on chromosome 17q. [provided by RefSeq, Apr 2009]
38 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4501835 Anti-TBC1D3, C-Terminal antibody produced in rabbit affinity isolated antibody human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001001417 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001417 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001417 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001417 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001417 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00303755 predicted 366
2 SASI_Hs02_00303756 predicted 432
3 SASI_Hs02_00303757 predicted 294
4 SASI_Hs02_00303758 predicted 374
5 SASI_Hs02_00303759 predicted 727
6 SASI_Hs02_00303760 predicted 596
7 SASI_Hs01_00065674 predicted 1044
8 SASI_Hs02_00303761 predicted 589
9 SASI_Hs02_00303762 predicted 589
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001417
TBC1D3B MISSION shRNA Bacterial Glycerol Stock
TBC1 domain family, member 3B
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000452941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001417.5-1039s21c1
Sequence:CCGGTTGATGCCGATAACAAGAATCCTCGAGGATTCTTGTTATCGGCATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000443064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001417.5-590s21c1
Sequence:CCGGGGGACATAAGCGGGACATTAACTCGAGTTAATGTCCCGCTTATGTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118537    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001417.3-1869s1c1
Sequence:CCGGGCTTGAGAGACATTCAGAGATCTCGAGATCTCTGAATGTCTCTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001417.3-438s1c1
Sequence:CCGGCCTCCTGAACATTGAGGAAATCTCGAGATTTCCTCAATGTTCAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001417.3-1119s1c1
Sequence:CCGGCAAGCATCTTAGGGCCTCTATCTCGAGATAGAGGCCCTAAGATGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001417.3-682s1c1
Sequence:CCGGGCCTTGTTCCTCCTCTATCTTCTCGAGAAGATAGAGGAGGAACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001417.3-909s1c1
Sequence:CCGGCCGGATATTGATTGACGGGATCTCGAGATCCCGTCAATCAATATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001417
TBC1D3B MISSION shRNA shRNA Plasmid DNA
TBC1 domain family, member 3B
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000452941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001417.5-1039s21c1
Sequence:CCGGTTGATGCCGATAACAAGAATCCTCGAGGATTCTTGTTATCGGCATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000443064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001417.5-590s21c1
Sequence:CCGGGGGACATAAGCGGGACATTAACTCGAGTTAATGTCCCGCTTATGTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118537    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001417.3-1869s1c1
Sequence:CCGGGCTTGAGAGACATTCAGAGATCTCGAGATCTCTGAATGTCTCTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001417.3-438s1c1
Sequence:CCGGCCTCCTGAACATTGAGGAAATCTCGAGATTTCCTCAATGTTCAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001417.3-1119s1c1
Sequence:CCGGCAAGCATCTTAGGGCCTCTATCTCGAGATAGAGGCCCTAAGATGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001417.3-682s1c1
Sequence:CCGGGCCTTGTTCCTCCTCTATCTTCTCGAGAAGATAGAGGAGGAACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001417.3-909s1c1
Sequence:CCGGCCGGATATTGATTGACGGGATCTCGAGATCCCGTCAATCAATATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001417
TBC1D3B MISSION shRNA Lentiviral Transduction Particles
TBC1 domain family, member 3B
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000452941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001417.5-1039s21c1
Sequence:CCGGTTGATGCCGATAACAAGAATCCTCGAGGATTCTTGTTATCGGCATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000443064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001417.5-590s21c1
Sequence:CCGGGGGACATAAGCGGGACATTAACTCGAGTTAATGTCCCGCTTATGTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118537    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001417.3-1869s1c1
Sequence:CCGGGCTTGAGAGACATTCAGAGATCTCGAGATCTCTGAATGTCTCTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001417.3-438s1c1
Sequence:CCGGCCTCCTGAACATTGAGGAAATCTCGAGATTTCCTCAATGTTCAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001417.3-1119s1c1
Sequence:CCGGCAAGCATCTTAGGGCCTCTATCTCGAGATAGAGGCCCTAAGATGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001417.3-682s1c1
Sequence:CCGGGCCTTGTTCCTCCTCTATCTTCTCGAGAAGATAGAGGAGGAACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001417.3-909s1c1
Sequence:CCGGCCGGATATTGATTGACGGGATCTCGAGATCCCGTCAATCAATATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks