EMAIL THIS PAGE TO A FRIEND

TBC1D3C

TBC1 domain family, member 3C

Synonyms: TBC1D3D
Species: Human TBC1D3C(414060)
UniProtKB ID: Q6IPX1
Gene ID:
Human(414060) Summary: This gene represents one of at least 8 paralogs of TBC1D3 gene found on chromosome 17. These paralogs appear to be differentially expressed in human tissues. The proteins encoded by this gene family contain a TBC (Tre-2, Bub2p, and Cdc16p) domain, which is found in proteins involved in RAB GTPase signaling and vesicle trafficking. [provided by RefSeq, May 2011]
54 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001001418 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001418 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001418 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001418 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001418 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00038359 predicted 360
2 SASI_Hs02_00303763 predicted 429
3 SASI_Hs01_00038361 predicted 285
4 SASI_Hs01_00038363 predicted 370
5 SASI_Hs01_00038367 predicted 599
6 SASI_Hs02_00303764 predicted 1030
7 SASI_Hs01_00038366 predicted 585
8 SASI_Hs02_00303765 predicted 580
9 SASI_Hs01_00038358 predicted 386
10 SASI_Hs01_00038360 predicted 363
11 SASI_Hs01_00038362 predicted 388
12 SASI_Hs01_00038364 predicted 374
13 SASI_Hs01_00038365 predicted 373
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001418
TBC1D3C MISSION shRNA Bacterial Glycerol Stock
TBC1 domain family, member 3C
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118542    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001418.2-1436s1c1
Sequence:CCGGCGATAACAAGAATCGCCTTTACTCGAGTAAAGGCGATTCTTGTTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001418.2-1019s1c1
Sequence:CCGGCCCAAAGGACACACAAGCAAACTCGAGTTTGCTTGTGTGTCCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001418.2-741s1c1
Sequence:CCGGCAGGGATTTCACAGCCCAAATCTCGAGATTTGGGCTGTGAAATCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001418.2-356s1c1
Sequence:CCGGGCTCATAGATCGAGCGTACAACTCGAGTTGTACGCTCGATCTATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001418.2-599s1c1
Sequence:CCGGCCTGGCATATGAGGAGTATAACTCGAGTTATACTCCTCATATGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001418
TBC1D3C MISSION shRNA shRNA Plasmid DNA
TBC1 domain family, member 3C
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118542    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001418.2-1436s1c1
Sequence:CCGGCGATAACAAGAATCGCCTTTACTCGAGTAAAGGCGATTCTTGTTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001418.2-1019s1c1
Sequence:CCGGCCCAAAGGACACACAAGCAAACTCGAGTTTGCTTGTGTGTCCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001418.2-741s1c1
Sequence:CCGGCAGGGATTTCACAGCCCAAATCTCGAGATTTGGGCTGTGAAATCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001418.2-356s1c1
Sequence:CCGGGCTCATAGATCGAGCGTACAACTCGAGTTGTACGCTCGATCTATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001418.2-599s1c1
Sequence:CCGGCCTGGCATATGAGGAGTATAACTCGAGTTATACTCCTCATATGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001418
TBC1D3C MISSION shRNA Lentiviral Transduction Particles
TBC1 domain family, member 3C
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118542    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001418.2-1436s1c1
Sequence:CCGGCGATAACAAGAATCGCCTTTACTCGAGTAAAGGCGATTCTTGTTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001418.2-1019s1c1
Sequence:CCGGCCCAAAGGACACACAAGCAAACTCGAGTTTGCTTGTGTGTCCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001418.2-741s1c1
Sequence:CCGGCAGGGATTTCACAGCCCAAATCTCGAGATTTGGGCTGTGAAATCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001418.2-356s1c1
Sequence:CCGGGCTCATAGATCGAGCGTACAACTCGAGTTGTACGCTCGATCTATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001418.2-599s1c1
Sequence:CCGGCCTGGCATATGAGGAGTATAACTCGAGTTATACTCCTCATATGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks