EMAIL THIS PAGE TO A FRIEND

TBC1D3G

TBC1 domain family, member 3G

Species: Human TBC1D3G(654341)
UniProtKB ID: Q6DHY5, A8K8H9
Gene ID:
53 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301804 ANTI-TBC1D3C (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001040282 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001040282 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001040282 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040282 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040282 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00140478 predicted 372
2 SASI_Hs02_00308930 predicted 441
3 SASI_Hs01_00140480 predicted 306
4 SASI_Hs01_00140482 predicted 377
5 SASI_Hs02_00308931 predicted 611
6 SASI_Hs02_00308932 predicted 1051
7 SASI_Hs02_00308933 predicted 592
8 SASI_Hs02_00308934 predicted 1898
9 SASI_Hs01_00140485 predicted 592
10 SASI_Hs02_00308935 predicted 1890
11 SASI_Hs01_00140477 predicted 386
12 SASI_Hs01_00140479 predicted 372
13 SASI_Hs01_00140481 predicted 390
14 SASI_Hs01_00140483 predicted 381
15 SASI_Hs01_00140484 predicted 374
16 SASI_Hs01_00140486 predicted 962
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001040282
TBC1D3G MISSION shRNA Bacterial Glycerol Stock
TBC1 domain family, member 3G
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040282.2-596s21c1
Sequence:CCGGCGGGACATAAGCGGGACATTACTCGAGTAATGTCCCGCTTATGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040282.2-1055s21c1
Sequence:CCGGATAACAAGAATCGCCTTTAAGCTCGAGCTTAAAGGCGATTCTTGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040282.2-1558s21c1
Sequence:CCGGTTGGTTCCGCCATTATGATTTCTCGAGAAATCATAATGGCGGAACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040282.2-197s21c1
Sequence:CCGGGAGCGAGAGGACATCATTATGCTCGAGCATAATGATGTCCTCTCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262160    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001040282.2-1822s21c1
Sequence:CCGGGGGCTCATGGCTGGATAATTTCTCGAGAAATTATCCAGCCATGAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001040282
TBC1D3G MISSION shRNA shRNA Plasmid DNA
TBC1 domain family, member 3G
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040282.2-596s21c1
Sequence:CCGGCGGGACATAAGCGGGACATTACTCGAGTAATGTCCCGCTTATGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040282.2-1055s21c1
Sequence:CCGGATAACAAGAATCGCCTTTAAGCTCGAGCTTAAAGGCGATTCTTGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040282.2-1558s21c1
Sequence:CCGGTTGGTTCCGCCATTATGATTTCTCGAGAAATCATAATGGCGGAACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040282.2-197s21c1
Sequence:CCGGGAGCGAGAGGACATCATTATGCTCGAGCATAATGATGTCCTCTCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262160    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001040282.2-1822s21c1
Sequence:CCGGGGGCTCATGGCTGGATAATTTCTCGAGAAATTATCCAGCCATGAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001040282
TBC1D3G MISSION shRNA Lentiviral Transduction Particles
TBC1 domain family, member 3G
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040282.2-596s21c1
Sequence:CCGGCGGGACATAAGCGGGACATTACTCGAGTAATGTCCCGCTTATGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040282.2-1055s21c1
Sequence:CCGGATAACAAGAATCGCCTTTAAGCTCGAGCTTAAAGGCGATTCTTGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040282.2-1558s21c1
Sequence:CCGGTTGGTTCCGCCATTATGATTTCTCGAGAAATCATAATGGCGGAACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040282.2-197s21c1
Sequence:CCGGGAGCGAGAGGACATCATTATGCTCGAGCATAATGATGTCCTCTCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262160    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001040282.2-1822s21c1
Sequence:CCGGGGGCTCATGGCTGGATAATTTCTCGAGAAATTATCCAGCCATGAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks