EMAIL THIS PAGE TO A FRIEND

TBC1D3H

TBC1 domain family, member 3H

Species: Human TBC1D3H(729877)
UniProtKB ID: P0C7X1, A6NH17, A8MZ78
Gene ID:
14 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301792 ANTI-TBC1D3H (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001123392 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001123392 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001123392 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001123392 Rosetta Predictions human pricing
XM_001134201 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001123392 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00327919 predicted 603
2 SASI_Hs02_00327920 predicted 1048
3 SASI_Hs02_00327921 predicted 596
4 SASI_Hs02_00327922 predicted 606
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001134201 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00391963 predicted 2047
2 SASI_Hs02_00391964 predicted 1893
3 SASI_Hs02_00391965 predicted 2040
4 SASI_Hs02_00391966 predicted 2056
5 SASI_Hs02_00391967 predicted 2496
6 SASI_Hs02_00391968 predicted 2040
7 SASI_Hs02_00391969 predicted 2058
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001123392
TBC1D3H MISSION shRNA Bacterial Glycerol Stock
TBC1 domain family, member 3H
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282350    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001123392.1-1823s21c1
Sequence:CCGGGGCTCATGGCTGGATAATTTCCTCGAGGAAATTATCCAGCCATGAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123392.1-489s21c1
Sequence:CCGGGGTCAGTCCTCCTGAACATTGCTCGAGCAATGTTCAGGAGGACTGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123392.1-610s21c1
Sequence:CCGGGACACTAAGGAAGCATATATTCTCGAGAATATATGCTTCCTTAGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123392.1-1559s21c1
Sequence:CCGGTGGTTCCGCCATTATGATTTCCTCGAGGAAATCATAATGGCGGAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123392.1-1041s21c1
Sequence:CCGGAGGCGTTGATGCCGATAACAACTCGAGTTGTTATCGGCATCAACGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001123392
TBC1D3H MISSION shRNA shRNA Plasmid DNA
TBC1 domain family, member 3H
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282350    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001123392.1-1823s21c1
Sequence:CCGGGGCTCATGGCTGGATAATTTCCTCGAGGAAATTATCCAGCCATGAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123392.1-489s21c1
Sequence:CCGGGGTCAGTCCTCCTGAACATTGCTCGAGCAATGTTCAGGAGGACTGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123392.1-610s21c1
Sequence:CCGGGACACTAAGGAAGCATATATTCTCGAGAATATATGCTTCCTTAGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123392.1-1559s21c1
Sequence:CCGGTGGTTCCGCCATTATGATTTCCTCGAGGAAATCATAATGGCGGAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123392.1-1041s21c1
Sequence:CCGGAGGCGTTGATGCCGATAACAACTCGAGTTGTTATCGGCATCAACGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001123392
TBC1D3H MISSION shRNA Lentiviral Transduction Particles
TBC1 domain family, member 3H
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282350    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001123392.1-1823s21c1
Sequence:CCGGGGCTCATGGCTGGATAATTTCCTCGAGGAAATTATCCAGCCATGAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123392.1-489s21c1
Sequence:CCGGGGTCAGTCCTCCTGAACATTGCTCGAGCAATGTTCAGGAGGACTGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123392.1-610s21c1
Sequence:CCGGGACACTAAGGAAGCATATATTCTCGAGAATATATGCTTCCTTAGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123392.1-1559s21c1
Sequence:CCGGTGGTTCCGCCATTATGATTTCCTCGAGGAAATCATAATGGCGGAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123392.1-1041s21c1
Sequence:CCGGAGGCGTTGATGCCGATAACAACTCGAGTTGTTATCGGCATCAACGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks