EMAIL THIS PAGE TO A FRIEND

TBC1D4

TBC1 domain family, member 4

Synonyms: AS160
Gene ID:
Mouse(210789) TBC1 domain family, member 4
Rat(306117) TBC1 domain family, member 4
chicken(428062) TBC1 domain family, member 4
domestic cat(101100706) TBC1 domain family, member 4
Horse(100051815) TBC1 domain family, member 4
dog(485494) TBC1 domain family, member 4
domestic guinea pig(100730955) TBC1 domain family, member 4
naked mole-rat(101719700) TBC1 domain family, member 4
cow(534649) TBC1 domain family, member 4
sheep(101123311) TBC1 domain family, member 4
156 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4200103 Anti-AS160 (C-terminal region) antibody produced in rabbit ~1.5 mg/mL, affinity isolated antibody human
immunofluorescence, western blot pricing
SAB4200102 Anti-AS160 (C-terminal) antibody produced in rabbit ~1.5 mg/mL human
western blot pricing
SAB4200101 Anti-AS160 antibody produced in rabbit ~1.5 mg/mL, affinity isolated antibody human
immunofluorescence, western blot pricing
SAB4503722 Anti-AS160 antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, immunofluorescence pricing
SAB2500122 Anti-AS160/TBC1D4 antibody produced in goat affinity isolated antibody, buffered aqueous solution human, canine
ELISA, immunohistochemistry, western blot pricing
SAB4503896 Anti-phospho-AS160 (pThr642) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry pricing
HPA040145 Anti-TBC1D4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
HPA059885 Anti-TBC1D4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
PLA0289 Rabbit anti-AS160 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. chimpanzee, primate, human, pig, marmoset, gibbon, gorilla
immunoprecipitation, proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014832 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014832 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014832 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081278 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081278 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081278 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014832 Rosetta Predictions human pricing
XM_224465 Rosetta Predictions rat pricing
NM_001081278 Rosetta Predictions mouse pricing
XM_619278 Rosetta Predictions mouse pricing
XM_884420 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014832 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00092357 predicted 1275
2 SASI_Hs01_00092360 predicted 3068
3 SASI_Hs01_00092361 predicted 2588
4 SASI_Hs01_00092362 predicted 2977
5 SASI_Hs01_00092363 predicted 1723
6 SASI_Hs02_00346386 predicted 3184
7 SASI_Hs01_00092364 predicted 860
8 SASI_Hs01_00092365 predicted 3328
9 SASI_Hs02_00346387 predicted 3134
10 SASI_Hs01_00092366 predicted 3009
11 SASI_Hs01_00092358 predicted 1786
12 SASI_Hs01_00092359 predicted 1461
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_224465 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00174153 predicted 1274
2 SASI_Rn01_00174154 predicted 3118
3 SASI_Rn01_00174155 predicted 2960
4 SASI_Rn01_00174156 predicted 1245
5 SASI_Rn01_00174157 predicted 2951
6 SASI_Rn01_00174158 predicted 1556
7 SASI_Rn01_00174159 predicted 1132
8 SASI_Rn01_00174160 predicted 2453
9 SASI_Rn01_00174161 predicted 3237
10 SASI_Rn01_00174162 predicted 2287
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081278 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00296907 predicted 1915
2 SASI_Mm02_00296908 predicted 1984
3 SASI_Mm02_00296909 predicted 1135
4 SASI_Mm02_00296910 predicted 2014
5 SASI_Mm02_00296911 predicted 4418
6 SASI_Mm02_00296912 predicted 2095
7 SASI_Mm02_00296913 predicted 3358
8 SASI_Mm02_00296914 predicted 4537
9 SASI_Mm02_00296915 predicted 2405
10 SASI_Mm02_00296916 predicted 3763
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_619278 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00207121 predicted 395
2 SASI_Mm01_00207122 predicted 410
3 SASI_Mm01_00207123 predicted 1613
4 SASI_Mm01_00207124 predicted 402
5 SASI_Mm01_00207125 predicted 561
6 SASI_Mm01_00207126 predicted 444
7 SASI_Mm01_00207127 predicted 551
8 SASI_Mm01_00207128 predicted 1042
9 SASI_Mm01_00207129 predicted 1634
10 SASI_Mm01_00207130 predicted 1730
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_884420 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00268655 predicted 3147
2 SASI_Mm01_00268656 predicted 3431
3 SASI_Mm01_00268657 predicted 2015
4 SASI_Mm01_00268658 predicted 1169
5 SASI_Mm01_00268659 predicted 2051
6 SASI_Mm01_00268660 predicted 2125
7 SASI_Mm01_00268661 predicted 3594
8 SASI_Mm01_00268662 predicted 4782
9 SASI_Mm01_00268663 predicted 3347
10 SASI_Mm01_00268664 predicted 2440
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014832
TBC1D4 MISSION shRNA Bacterial Glycerol Stock
TBC1 domain family, member 4
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000148287    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014832.1-5181s1c1
Sequence:CCGGCCAAATTGTGAGTGCTTGTAACTCGAGTTACAAGCACTCACAATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014832.1-4212s1c1
Sequence:CCGGCCTAACAACAAAGCCAAGATACTCGAGTATCTTGGCTTTGTTGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147574    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014832.1-5772s1c1
Sequence:CCGGGCTTTGATGAACAGATGACAACTCGAGTTGTCATCTGTTCATCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014832.1-3012s1c1
Sequence:CCGGGAGGTCTTAATAACTTGGGATCTCGAGATCCCAAGTTATTAAGACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014832
TBC1D4 MISSION shRNA shRNA Plasmid DNA
TBC1 domain family, member 4
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000148287    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014832.1-5181s1c1
Sequence:CCGGCCAAATTGTGAGTGCTTGTAACTCGAGTTACAAGCACTCACAATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014832.1-4212s1c1
Sequence:CCGGCCTAACAACAAAGCCAAGATACTCGAGTATCTTGGCTTTGTTGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147574    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014832.1-5772s1c1
Sequence:CCGGGCTTTGATGAACAGATGACAACTCGAGTTGTCATCTGTTCATCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014832.1-3012s1c1
Sequence:CCGGGAGGTCTTAATAACTTGGGATCTCGAGATCCCAAGTTATTAAGACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014832
TBC1D4 MISSION shRNA Lentiviral Transduction Particles
TBC1 domain family, member 4
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000148287    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014832.1-5181s1c1
Sequence:CCGGCCAAATTGTGAGTGCTTGTAACTCGAGTTACAAGCACTCACAATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014832.1-4212s1c1
Sequence:CCGGCCTAACAACAAAGCCAAGATACTCGAGTATCTTGGCTTTGTTGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147574    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014832.1-5772s1c1
Sequence:CCGGGCTTTGATGAACAGATGACAACTCGAGTTGTCATCTGTTCATCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014832.1-3012s1c1
Sequence:CCGGGAGGTCTTAATAACTTGGGATCTCGAGATCCCAAGTTATTAAGACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081278
TBC1D4 MISSION shRNA Bacterial Glycerol Stock
TBC1 domain family, member 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000241612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081278.2-1137s21c1
Sequence:CCGGCTCACCTACTTTGCCTATTTGCTCGAGCAAATAGGCAAAGTAGGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081278.2-4084s21c1
Sequence:CCGGACGCCTATGAGGTAGAATATCCTCGAGGATATTCTACCTCATAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241614    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081278.2-6072s21c1
Sequence:CCGGTTCTAGGAAGTGCTGATTATTCTCGAGAATAATCAGCACTTCCTAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081278.2-2085s21c1
Sequence:CCGGAGTGCCAAGACGCAGATTAAACTCGAGTTTAATCTGCGTCTTGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081278.2-3217s21c1
Sequence:CCGGCATGTCAGAAGGAGATCTTAACTCGAGTTAAGATCTCCTTCTGACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081278
TBC1D4 MISSION shRNA shRNA Plasmid DNA
TBC1 domain family, member 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000241612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081278.2-1137s21c1
Sequence:CCGGCTCACCTACTTTGCCTATTTGCTCGAGCAAATAGGCAAAGTAGGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081278.2-4084s21c1
Sequence:CCGGACGCCTATGAGGTAGAATATCCTCGAGGATATTCTACCTCATAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241614    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081278.2-6072s21c1
Sequence:CCGGTTCTAGGAAGTGCTGATTATTCTCGAGAATAATCAGCACTTCCTAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081278.2-2085s21c1
Sequence:CCGGAGTGCCAAGACGCAGATTAAACTCGAGTTTAATCTGCGTCTTGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081278.2-3217s21c1
Sequence:CCGGCATGTCAGAAGGAGATCTTAACTCGAGTTAAGATCTCCTTCTGACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081278
TBC1D4 MISSION shRNA Lentiviral Transduction Particles
TBC1 domain family, member 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000241612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081278.2-1137s21c1
Sequence:CCGGCTCACCTACTTTGCCTATTTGCTCGAGCAAATAGGCAAAGTAGGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081278.2-4084s21c1
Sequence:CCGGACGCCTATGAGGTAGAATATCCTCGAGGATATTCTACCTCATAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241614    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081278.2-6072s21c1
Sequence:CCGGTTCTAGGAAGTGCTGATTATTCTCGAGAATAATCAGCACTTCCTAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081278.2-2085s21c1
Sequence:CCGGAGTGCCAAGACGCAGATTAAACTCGAGTTTAATCTGCGTCTTGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081278.2-3217s21c1
Sequence:CCGGCATGTCAGAAGGAGATCTTAACTCGAGTTAAGATCTCCTTCTGACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks