EMAIL THIS PAGE TO A FRIEND

TBC1D5

TBC1 domain family, member 5

UniProtKB ID: Q92609, A6NP25, C9JP52
Gene ID:
Mouse(72238) TBC1 domain family, member 5
Rat(501088) TBC1 domain family, member 5
Zebrafish(393583) TBC1 domain family, member 5
Horse(100052179) TBC1 domain family, member 5
dog(485651) TBC1 domain family, member 5
chicken(420646) TBC1 domain family, member 5
cow(614554) TBC1 domain family, member 5
sheep(101114748) TBC1 domain family, member 5
naked mole-rat(101724991) TBC1 domain family, member 5
Domestic Rabbit(100347069) TBC1 domain family, member 5
domestic guinea pig(100720938) TBC1 domain family, member 5
73 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014744 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014744 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014744 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028162 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028162 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028162 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU002251 MISSION® esiRNA esiRNA targeting human TBC1D5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014744 Rosetta Predictions human pricing
NM_001134762 Rosetta Predictions rat pricing
XM_001056443 Rosetta Predictions rat pricing
NM_028162 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014744 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00057354 predicted 2787
2 SASI_Hs02_00346209 predicted 2489
3 SASI_Hs01_00057355 predicted 2040
4 SASI_Hs01_00057356 predicted 3028
5 SASI_Hs01_00057357 predicted 1989
6 SASI_Hs01_00057359 predicted 2862
7 SASI_Hs01_00057360 predicted 2287
8 SASI_Hs01_00057361 predicted 3221
9 SASI_Hs01_00057362 predicted 3486
10 SASI_Hs02_00346210 predicted 2144
11 SASI_Hs01_00057353 predicted 2638
12 SASI_Hs01_00057358 predicted 2924
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134762 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00258434 predicted 1255
2 SASI_Rn02_00258435 predicted 618
3 SASI_Rn02_00258436 predicted 1242
4 SASI_Rn02_00258437 predicted 1017
5 SASI_Rn02_00258438 predicted 2117
6 SASI_Rn02_00258439 predicted 741
7 SASI_Rn02_00258440 predicted 420
8 SASI_Rn02_00258441 predicted 408
9 SASI_Rn02_00258442 predicted 553
10 SASI_Rn02_00258443 predicted 2268
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056443 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00283306 predicted 1250
2 SASI_Rn02_00283307 predicted 622
3 SASI_Rn02_00283308 predicted 1243
4 SASI_Rn02_00283309 predicted 1017
5 SASI_Rn02_00283310 predicted 2118
6 SASI_Rn02_00283311 predicted 735
7 SASI_Rn02_00283312 predicted 424
8 SASI_Rn02_00283313 predicted 408
9 SASI_Rn02_00283314 predicted 545
10 SASI_Rn02_00283315 predicted 2264
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028162 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00171784 predicted 1066
2 SASI_Mm01_00171785 predicted 778
3 SASI_Mm01_00171786 predicted 1474
4 SASI_Mm01_00171787 predicted 1308
5 SASI_Mm01_00171788 predicted 676
6 SASI_Mm01_00171789 predicted 1551
7 SASI_Mm01_00171790 predicted 487
8 SASI_Mm01_00171791 predicted 1291
9 SASI_Mm01_00171792 predicted 971
10 SASI_Mm01_00171793 predicted 1102
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014744
VALIDATED
TBC1D5 MISSION shRNA Bacterial Glycerol Stock
TBC1 domain family, member 5
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000281193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_014744.2-3493s21c1
Sequence:CCGGGCAAAGGTGATGGACACTCATCTCGAGATGAGTGTCCATCACCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_014744.2-3213s21c1
Sequence:CCGGGCTGATGAAATCAGAAAGCATCTCGAGATGCTTTCTGATTTCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_014744.2-3655s21c1
Sequence:CCGGGAGAACGAACAGATCACCATTCTCGAGAATGGTGATCTGTTCGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_014744.2-3477s21c1
Sequence:CCGGCATGTGCAAATACTGTGCAAACTCGAGTTTGCACAGTATTTGCACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_014744.1-3492s1c1
Sequence:CCGGGCAAAGGTGATGGACACTCATCTCGAGATGAGTGTCCATCACCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_014744.1-3476s1c1
Sequence:CCGGCATGTGCAAATACTGTGCAAACTCGAGTTTGCACAGTATTTGCACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_014744.1-3212s1c1
Sequence:CCGGGCTGATGAAATCAGAAAGCATCTCGAGATGCTTTCTGATTTCATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138715    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014744.1-4298s1c1
Sequence:CCGGGCTCTGAGTTAGAGCTGAGTTCTCGAGAACTCAGCTCTAACTCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_014744.1-3654s1c1
Sequence:CCGGGAGAACGAACAGATCACCATTCTCGAGAATGGTGATCTGTTCGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014744
VALIDATED
TBC1D5 MISSION shRNA shRNA Plasmid DNA
TBC1 domain family, member 5
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000281193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_014744.2-3493s21c1
Sequence:CCGGGCAAAGGTGATGGACACTCATCTCGAGATGAGTGTCCATCACCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_014744.2-3213s21c1
Sequence:CCGGGCTGATGAAATCAGAAAGCATCTCGAGATGCTTTCTGATTTCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_014744.2-3655s21c1
Sequence:CCGGGAGAACGAACAGATCACCATTCTCGAGAATGGTGATCTGTTCGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_014744.2-3477s21c1
Sequence:CCGGCATGTGCAAATACTGTGCAAACTCGAGTTTGCACAGTATTTGCACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_014744.1-3492s1c1
Sequence:CCGGGCAAAGGTGATGGACACTCATCTCGAGATGAGTGTCCATCACCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_014744.1-3476s1c1
Sequence:CCGGCATGTGCAAATACTGTGCAAACTCGAGTTTGCACAGTATTTGCACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_014744.1-3212s1c1
Sequence:CCGGGCTGATGAAATCAGAAAGCATCTCGAGATGCTTTCTGATTTCATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138715    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014744.1-4298s1c1
Sequence:CCGGGCTCTGAGTTAGAGCTGAGTTCTCGAGAACTCAGCTCTAACTCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_014744.1-3654s1c1
Sequence:CCGGGAGAACGAACAGATCACCATTCTCGAGAATGGTGATCTGTTCGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014744
VALIDATED
TBC1D5 MISSION shRNA Lentiviral Transduction Particles
TBC1 domain family, member 5
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000281193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_014744.2-3493s21c1
Sequence:CCGGGCAAAGGTGATGGACACTCATCTCGAGATGAGTGTCCATCACCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_014744.2-3213s21c1
Sequence:CCGGGCTGATGAAATCAGAAAGCATCTCGAGATGCTTTCTGATTTCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_014744.2-3655s21c1
Sequence:CCGGGAGAACGAACAGATCACCATTCTCGAGAATGGTGATCTGTTCGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_014744.2-3477s21c1
Sequence:CCGGCATGTGCAAATACTGTGCAAACTCGAGTTTGCACAGTATTTGCACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_014744.1-3492s1c1
Sequence:CCGGGCAAAGGTGATGGACACTCATCTCGAGATGAGTGTCCATCACCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_014744.1-3476s1c1
Sequence:CCGGCATGTGCAAATACTGTGCAAACTCGAGTTTGCACAGTATTTGCACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_014744.1-3212s1c1
Sequence:CCGGGCTGATGAAATCAGAAAGCATCTCGAGATGCTTTCTGATTTCATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138715    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014744.1-4298s1c1
Sequence:CCGGGCTCTGAGTTAGAGCTGAGTTCTCGAGAACTCAGCTCTAACTCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_014744.1-3654s1c1
Sequence:CCGGGAGAACGAACAGATCACCATTCTCGAGAATGGTGATCTGTTCGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028162
VALIDATED
TBC1D5 MISSION shRNA Bacterial Glycerol Stock
TBC1 domain family, member 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000178424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028162.2-671s1c1
Sequence:CCGGGAGCCTGGTATAGCAGTATTACTCGAGTAATACTGCTATACCAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028162.2-1612s1c1
Sequence:CCGGCCCAACTTAGACTACTACAAACTCGAGTTTGTAGTAGTCTAAGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198467    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028162.2-3256s1c1
Sequence:CCGGGCAGGGTTTCAGATTAGGAATCTCGAGATTCCTAATCTGAAACCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197930    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028162.2-4313s1c1
Sequence:CCGGGCGTTGAGAATAAGGTCAATACTCGAGTATTGACCTTATTCTCAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028162.2-2009s1c1
Sequence:CCGGCCATCAGTTCATCTCCAAGTACTCGAGTACTTGGAGATGAACTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028162
VALIDATED
TBC1D5 MISSION shRNA shRNA Plasmid DNA
TBC1 domain family, member 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000178424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028162.2-671s1c1
Sequence:CCGGGAGCCTGGTATAGCAGTATTACTCGAGTAATACTGCTATACCAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028162.2-1612s1c1
Sequence:CCGGCCCAACTTAGACTACTACAAACTCGAGTTTGTAGTAGTCTAAGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198467    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028162.2-3256s1c1
Sequence:CCGGGCAGGGTTTCAGATTAGGAATCTCGAGATTCCTAATCTGAAACCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197930    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028162.2-4313s1c1
Sequence:CCGGGCGTTGAGAATAAGGTCAATACTCGAGTATTGACCTTATTCTCAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028162.2-2009s1c1
Sequence:CCGGCCATCAGTTCATCTCCAAGTACTCGAGTACTTGGAGATGAACTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028162
VALIDATED
TBC1D5 MISSION shRNA Lentiviral Transduction Particles
TBC1 domain family, member 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000178424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028162.2-671s1c1
Sequence:CCGGGAGCCTGGTATAGCAGTATTACTCGAGTAATACTGCTATACCAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028162.2-1612s1c1
Sequence:CCGGCCCAACTTAGACTACTACAAACTCGAGTTTGTAGTAGTCTAAGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198467    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028162.2-3256s1c1
Sequence:CCGGGCAGGGTTTCAGATTAGGAATCTCGAGATTCCTAATCTGAAACCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197930    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028162.2-4313s1c1
Sequence:CCGGGCGTTGAGAATAAGGTCAATACTCGAGTATTGACCTTATTCTCAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028162.2-2009s1c1
Sequence:CCGGCCATCAGTTCATCTCCAAGTACTCGAGTACTTGGAGATGAACTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks