EMAIL THIS PAGE TO A FRIEND

TBC1D7

TBC1 domain family, member 7

Synonyms: PIG51 TBC7 dJ257A7.3
Gene ID:
Human(51256) Summary: TBC1D7 belongs to a family of proteins sharing a 180- to 200-amino acid TBC domain presumed to have a role in regulating cell growth and differentiation. These proteins share significant homology with TRE2 (USP6; MIM 604334), yeast Bub2, and CDC16 (MIM 603461) (Nakashima et al., 2007 [PubMed 17658474]
Mouse(67046) TBC1 domain family, member 7
Rat(361227) TBC1 domain family, member 7
domestic guinea pig(100716907) TBC1 domain family, member 7
naked mole-rat(101722657) TBC1 domain family, member 7
cow(532704) TBC1 domain family, member 7
sheep(101104613) TBC1 domain family, member 7
Goat(100860990) TBC1 domain family, member 7
Zebrafish(393750) TBC1 domain family, member 7
chicken(420853) TBC1 domain family, member 7
dog(478725) TBC1 domain family, member 7
domestic cat(101090689) TBC1 domain family, member 7
59 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025935 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025935 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025935 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016495 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016495 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016495 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016495 Rosetta Predictions human pricing
NM_001108411 Rosetta Predictions rat pricing
NM_025935 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016495 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00145824 predicted 688
2 SASI_Hs01_00145825 predicted 205
3 SASI_Hs01_00145826 predicted 858
4 SASI_Hs01_00145827 predicted 477
5 SASI_Hs01_00145828 predicted 768
6 SASI_Hs02_00349560 predicted 196
7 SASI_Hs01_00145829 predicted 618
8 SASI_Hs01_00145830 predicted 249
9 SASI_Hs01_00145831 predicted 519
10 SASI_Hs01_00145832 predicted 356
11 SASI_Hs01_00145823 predicted 725
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108411 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00238399 predicted 1031
2 SASI_Rn02_00238400 predicted 586
3 SASI_Rn02_00238401 predicted 518
4 SASI_Rn02_00238402 predicted 807
5 SASI_Rn02_00238403 predicted 391
6 SASI_Rn02_00238404 predicted 720
7 SASI_Rn02_00238405 predicted 477
8 SASI_Rn02_00238406 predicted 754
9 SASI_Rn02_00238407 predicted 882
10 SASI_Rn02_00238408 predicted 964
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025935 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00104459 predicted 281
2 SASI_Mm01_00104460 predicted 583
3 SASI_Mm01_00104461 predicted 253
4 SASI_Mm01_00104462 predicted 526
5 SASI_Mm01_00104463 predicted 744
6 SASI_Mm01_00104464 predicted 336
7 SASI_Mm01_00104465 predicted 274
8 SASI_Mm01_00104466 predicted 739
9 SASI_Mm01_00104467 predicted 819
10 SASI_Mm01_00104468 predicted 661
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025935
VALIDATED
TBC1D7 MISSION shRNA Bacterial Glycerol Stock
TBC1 domain family, member 7
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183267    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025935.1-382s1c1
Sequence:CCGGGAAGTGTATCTTCGCATGTATCTCGAGATACATGCGAAGATACACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180645    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025935.1-309s1c1
Sequence:CCGGCAAAGACCAGTACCATGACATCTCGAGATGTCATGGTACTGGTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215598    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025935.2-94s1c1
Sequence:CCGGGATCAGTCTACTATGAGAAAGCTCGAGCTTTCTCATAGTAGACTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025935.2-181s21c1
Sequence:CCGGTCGAGAAGCTTTGCACATTTACTCGAGTAAATGTGCAAAGCTTCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025935.2-556s21c1
Sequence:CCGGACAAGTACAGGGACGCTTTACCTCGAGGTAAAGCGTCCCTGTACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025935.2-778s21c1
Sequence:CCGGTAGCGGTAGAAATACTATTAACTCGAGTTAATAGTATTTCTACCGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025935.2-247s21c1
Sequence:CCGGAGGCGCTTCTAGGCATCTTACCTCGAGGTAAGATGCCTAGAAGCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025935
VALIDATED
TBC1D7 MISSION shRNA shRNA Plasmid DNA
TBC1 domain family, member 7
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183267    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025935.1-382s1c1
Sequence:CCGGGAAGTGTATCTTCGCATGTATCTCGAGATACATGCGAAGATACACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180645    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025935.1-309s1c1
Sequence:CCGGCAAAGACCAGTACCATGACATCTCGAGATGTCATGGTACTGGTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215598    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025935.2-94s1c1
Sequence:CCGGGATCAGTCTACTATGAGAAAGCTCGAGCTTTCTCATAGTAGACTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025935.2-181s21c1
Sequence:CCGGTCGAGAAGCTTTGCACATTTACTCGAGTAAATGTGCAAAGCTTCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025935.2-556s21c1
Sequence:CCGGACAAGTACAGGGACGCTTTACCTCGAGGTAAAGCGTCCCTGTACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025935.2-778s21c1
Sequence:CCGGTAGCGGTAGAAATACTATTAACTCGAGTTAATAGTATTTCTACCGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025935.2-247s21c1
Sequence:CCGGAGGCGCTTCTAGGCATCTTACCTCGAGGTAAGATGCCTAGAAGCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025935
VALIDATED
TBC1D7 MISSION shRNA Lentiviral Transduction Particles
TBC1 domain family, member 7
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183267    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025935.1-382s1c1
Sequence:CCGGGAAGTGTATCTTCGCATGTATCTCGAGATACATGCGAAGATACACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180645    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025935.1-309s1c1
Sequence:CCGGCAAAGACCAGTACCATGACATCTCGAGATGTCATGGTACTGGTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215598    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025935.2-94s1c1
Sequence:CCGGGATCAGTCTACTATGAGAAAGCTCGAGCTTTCTCATAGTAGACTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025935.2-181s21c1
Sequence:CCGGTCGAGAAGCTTTGCACATTTACTCGAGTAAATGTGCAAAGCTTCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025935.2-556s21c1
Sequence:CCGGACAAGTACAGGGACGCTTTACCTCGAGGTAAAGCGTCCCTGTACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025935.2-778s21c1
Sequence:CCGGTAGCGGTAGAAATACTATTAACTCGAGTTAATAGTATTTCTACCGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025935.2-247s21c1
Sequence:CCGGAGGCGCTTCTAGGCATCTTACCTCGAGGTAAGATGCCTAGAAGCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016495
VALIDATED
TBC1D7 MISSION shRNA Bacterial Glycerol Stock
TBC1 domain family, member 7
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_016495.2-334s1c1
Sequence:CCGGCGTAAGGAGCAGTACTTGGATCTCGAGATCCAAGTACTGCTCCTTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136017    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016495.2-273s1c1
Sequence:CCGGGAAGGTGCTTCTAGGAATCTTCTCGAGAAGATTCCTAGAAGCACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_016495.2-373s1c1
Sequence:CCGGGTCGTTCGCTTTGTTAGTGATCTCGAGATCACTAACAAAGCGAACGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_016495.2-200s1c1
Sequence:CCGGGTCTGGATACTGAGAAACTTTCTCGAGAAAGTTTCTCAGTATCCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_016495.2-318s1c1
Sequence:CCGGCAAGGTGATGATGTATCGTAACTCGAGTTACGATACATCATCACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_016495.2-687s1c1
Sequence:CCGGGCCCAAACTTCCTTATGATCTCTCGAGAGATCATAAGGAAGTTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016495.3-719s21c1
Sequence:CCGGACGCTTTGTGAACCAATTAAACTCGAGTTTAATTGGTTCACAAAGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016495.3-930s21c1
Sequence:CCGGGTTGTGAGTGGATCCTGTAAGCTCGAGCTTACAGGATCCACTCACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016495.3-884s21c1
Sequence:CCGGTGCGGGATGTTTGCCTGAATCCTCGAGGATTCAGGCAAACATCCCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016495
VALIDATED
TBC1D7 MISSION shRNA shRNA Plasmid DNA
TBC1 domain family, member 7
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_016495.2-334s1c1
Sequence:CCGGCGTAAGGAGCAGTACTTGGATCTCGAGATCCAAGTACTGCTCCTTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136017    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016495.2-273s1c1
Sequence:CCGGGAAGGTGCTTCTAGGAATCTTCTCGAGAAGATTCCTAGAAGCACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_016495.2-373s1c1
Sequence:CCGGGTCGTTCGCTTTGTTAGTGATCTCGAGATCACTAACAAAGCGAACGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_016495.2-200s1c1
Sequence:CCGGGTCTGGATACTGAGAAACTTTCTCGAGAAAGTTTCTCAGTATCCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_016495.2-318s1c1
Sequence:CCGGCAAGGTGATGATGTATCGTAACTCGAGTTACGATACATCATCACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_016495.2-687s1c1
Sequence:CCGGGCCCAAACTTCCTTATGATCTCTCGAGAGATCATAAGGAAGTTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016495.3-719s21c1
Sequence:CCGGACGCTTTGTGAACCAATTAAACTCGAGTTTAATTGGTTCACAAAGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016495.3-930s21c1
Sequence:CCGGGTTGTGAGTGGATCCTGTAAGCTCGAGCTTACAGGATCCACTCACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016495.3-884s21c1
Sequence:CCGGTGCGGGATGTTTGCCTGAATCCTCGAGGATTCAGGCAAACATCCCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016495
VALIDATED
TBC1D7 MISSION shRNA Lentiviral Transduction Particles
TBC1 domain family, member 7
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_016495.2-334s1c1
Sequence:CCGGCGTAAGGAGCAGTACTTGGATCTCGAGATCCAAGTACTGCTCCTTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136017    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016495.2-273s1c1
Sequence:CCGGGAAGGTGCTTCTAGGAATCTTCTCGAGAAGATTCCTAGAAGCACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_016495.2-373s1c1
Sequence:CCGGGTCGTTCGCTTTGTTAGTGATCTCGAGATCACTAACAAAGCGAACGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_016495.2-200s1c1
Sequence:CCGGGTCTGGATACTGAGAAACTTTCTCGAGAAAGTTTCTCAGTATCCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_016495.2-318s1c1
Sequence:CCGGCAAGGTGATGATGTATCGTAACTCGAGTTACGATACATCATCACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_016495.2-687s1c1
Sequence:CCGGGCCCAAACTTCCTTATGATCTCTCGAGAGATCATAAGGAAGTTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016495.3-719s21c1
Sequence:CCGGACGCTTTGTGAACCAATTAAACTCGAGTTTAATTGGTTCACAAAGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016495.3-930s21c1
Sequence:CCGGGTTGTGAGTGGATCCTGTAAGCTCGAGCTTACAGGATCCACTCACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016495.3-884s21c1
Sequence:CCGGTGCGGGATGTTTGCCTGAATCCTCGAGGATTCAGGCAAACATCCCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks