EMAIL THIS PAGE TO A FRIEND

TBC1D8

TBC1 domain family, member 8 (with GRAM domain)

Synonyms: AD3 HBLP1 TBC1D8A VRP
UniProtKB ID: O95759, A6NDL4, A8K9W1, B9A6K4, Q53SQ4, Q9UQ32
Gene ID:
Mouse(54610) TBC1 domain family, member 8
Rat(680133) TBC1 domain family, member 8
Zebrafish(100333881) TBC1 domain family, member 8 (with GRAM domain)
chicken(428012) TBC1 domain family, member 8 (with GRAM domain)
dog(474551) TBC1 domain family, member 8 (with GRAM domain)
domestic cat(101081972) TBC1 domain family, member 8 (with GRAM domain)
Horse(100059196) TBC1 domain family, member 8 (with GRAM domain)
cow(527162) TBC1 domain family, member 8 (with GRAM domain)
sheep(101103960) TBC1 domain family, member 8 (with GRAM domain)
naked mole-rat(101705253) TBC1 domain family, member 8 (with GRAM domain)
domestic guinea pig(100721531) TBC1 domain family, member 8 (with GRAM domain)
75 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001102426 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001102426 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001102426 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007063 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007063 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007063 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_018775 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018775 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018775 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001102426 Rosetta Predictions human pricing
NM_007063 Rosetta Predictions human pricing
XM_001055675 Rosetta Predictions rat pricing
XM_001055741 Rosetta Predictions rat pricing
XM_001055799 Rosetta Predictions rat pricing
NM_018775 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001102426 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00323143 predicted 752
2 SASI_Hs02_00323144 predicted 3625
3 SASI_Hs02_00323145 predicted 2991
4 SASI_Hs02_00323146 predicted 3471
5 SASI_Hs02_00323147 predicted 3447
6 SASI_Hs02_00323148 predicted 2843
7 SASI_Hs02_00323149 predicted 3523
8 SASI_Hs02_00323150 predicted 1118
9 SASI_Hs02_00323151 predicted 3335
10 SASI_Hs02_00323152 predicted 813
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007063 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00219712 predicted 3445
2 SASI_Hs01_00219713 predicted 3335
3 SASI_Hs01_00219714 predicted 2824
4 SASI_Hs01_00219715 predicted 3300
5 SASI_Hs01_00219716 predicted 3273
6 SASI_Hs01_00219717 predicted 2671
7 SASI_Hs01_00219718 predicted 3354
8 SASI_Hs01_00219719 predicted 943
9 SASI_Hs01_00219720 predicted 2132
10 SASI_Hs01_00219721 predicted 2437
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055675 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00280591 predicted 2862
2 SASI_Rn02_00280592 predicted 1875
3 SASI_Rn02_00280593 predicted 1608
4 SASI_Rn02_00280594 predicted 2355
5 SASI_Rn02_00280595 predicted 1760
6 SASI_Rn02_00280596 predicted 2882
7 SASI_Rn02_00280597 predicted 845
8 SASI_Rn02_00280598 predicted 1029
9 SASI_Rn02_00280599 predicted 1214
10 SASI_Rn02_00280600 predicted 715
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055741 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00280820 predicted 2798
2 SASI_Rn02_00280821 predicted 1806
3 SASI_Rn02_00280822 predicted 3000
4 SASI_Rn02_00280823 predicted 2981
5 SASI_Rn02_00280824 predicted 3079
6 SASI_Rn02_00280825 predicted 3440
7 SASI_Rn02_00280826 predicted 1695
8 SASI_Rn02_00280827 predicted 2816
9 SASI_Rn02_00280828 predicted 1028
10 SASI_Rn02_00280829 predicted 717
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055799 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00281055 predicted 2866
2 SASI_Rn02_00281056 predicted 1869
3 SASI_Rn02_00281057 predicted 1615
4 SASI_Rn02_00281058 predicted 3072
5 SASI_Rn02_00281059 predicted 3048
6 SASI_Rn02_00281060 predicted 3148
7 SASI_Rn02_00281061 predicted 3514
8 SASI_Rn02_00281062 predicted 1769
9 SASI_Rn02_00281063 predicted 2882
10 SASI_Rn02_00281064 predicted 1020
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018775 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00324086 predicted 3464
2 SASI_Mm01_00175199 predicted 2417
3 SASI_Mm01_00175200 predicted 391
4 SASI_Mm01_00175201 predicted 3497
5 SASI_Mm01_00175202 predicted 3061
6 SASI_Mm01_00175203 predicted 2873
7 SASI_Mm01_00175204 predicted 2744
8 SASI_Mm01_00175206 predicted 3194
9 SASI_Mm01_00175207 predicted 2644
10 SASI_Mm01_00175208 predicted 1368
11 SASI_Mm01_00175205 predicted 708
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001102426
VALIDATED
TBC1D8 MISSION shRNA Bacterial Glycerol Stock
TBC1 domain family, member 8 (with GRAM domain)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000331121    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001102426.1-3634s21c1
Sequence:CCGGCCGAGATTTCAGTCTACCTTACTCGAGTAAGGTAGACTGAAATCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_001102426.1-2531s21c1
Sequence:CCGGGAACGTGCTTCGAGTCGTTATCTCGAGATAACGACTCGAAGCACGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_001102426.1-2839s21c1
Sequence:CCGGGCTGCCTCGATATTATGTATACTCGAGTATACATAATATCGAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102426.1-1829s21c1
Sequence:CCGGCGAAACGGGAATTGCTGCTTTCTCGAGAAAGCAGCAATTCCCGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102426.1-790s21c1
Sequence:CCGGTCCGAATCACCACGCAGAATACTCGAGTATTCTGCGTGGTGATTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001102426
VALIDATED
TBC1D8 MISSION shRNA shRNA Plasmid DNA
TBC1 domain family, member 8 (with GRAM domain)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000331121    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001102426.1-3634s21c1
Sequence:CCGGCCGAGATTTCAGTCTACCTTACTCGAGTAAGGTAGACTGAAATCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_001102426.1-2531s21c1
Sequence:CCGGGAACGTGCTTCGAGTCGTTATCTCGAGATAACGACTCGAAGCACGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_001102426.1-2839s21c1
Sequence:CCGGGCTGCCTCGATATTATGTATACTCGAGTATACATAATATCGAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102426.1-1829s21c1
Sequence:CCGGCGAAACGGGAATTGCTGCTTTCTCGAGAAAGCAGCAATTCCCGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102426.1-790s21c1
Sequence:CCGGTCCGAATCACCACGCAGAATACTCGAGTATTCTGCGTGGTGATTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001102426
VALIDATED
TBC1D8 MISSION shRNA Lentiviral Transduction Particles
TBC1 domain family, member 8 (with GRAM domain)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000331121    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001102426.1-3634s21c1
Sequence:CCGGCCGAGATTTCAGTCTACCTTACTCGAGTAAGGTAGACTGAAATCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_001102426.1-2531s21c1
Sequence:CCGGGAACGTGCTTCGAGTCGTTATCTCGAGATAACGACTCGAAGCACGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_001102426.1-2839s21c1
Sequence:CCGGGCTGCCTCGATATTATGTATACTCGAGTATACATAATATCGAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102426.1-1829s21c1
Sequence:CCGGCGAAACGGGAATTGCTGCTTTCTCGAGAAAGCAGCAATTCCCGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102426.1-790s21c1
Sequence:CCGGTCCGAATCACCACGCAGAATACTCGAGTATTCTGCGTGGTGATTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007063
TBC1D8 MISSION shRNA Bacterial Glycerol Stock
TBC1 domain family, member 8 (with GRAM domain)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107060    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007063.2-3454s1c1
Sequence:CCGGCCGAGATTTCAGTCTACCTTACTCGAGTAAGGTAGACTGAAATCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007063.2-2212s1c1
Sequence:CCGGCCTACCCTGTGACTGATATTTCTCGAGAAATATCAGTCACAGGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007063.2-1649s1c1
Sequence:CCGGCGAAACGGGAATTGCTGCTTTCTCGAGAAAGCAGCAATTCCCGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007063.2-2659s1c1
Sequence:CCGGGCTGCCTCGATATTATGTATACTCGAGTATACATAATATCGAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007063.2-3338s1c1
Sequence:CCGGCCAATCACAATCTGAACTTAACTCGAGTTAAGTTCAGATTGTGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007063
TBC1D8 MISSION shRNA shRNA Plasmid DNA
TBC1 domain family, member 8 (with GRAM domain)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107060    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007063.2-3454s1c1
Sequence:CCGGCCGAGATTTCAGTCTACCTTACTCGAGTAAGGTAGACTGAAATCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007063.2-2212s1c1
Sequence:CCGGCCTACCCTGTGACTGATATTTCTCGAGAAATATCAGTCACAGGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007063.2-1649s1c1
Sequence:CCGGCGAAACGGGAATTGCTGCTTTCTCGAGAAAGCAGCAATTCCCGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007063.2-2659s1c1
Sequence:CCGGGCTGCCTCGATATTATGTATACTCGAGTATACATAATATCGAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007063.2-3338s1c1
Sequence:CCGGCCAATCACAATCTGAACTTAACTCGAGTTAAGTTCAGATTGTGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007063
TBC1D8 MISSION shRNA Lentiviral Transduction Particles
TBC1 domain family, member 8 (with GRAM domain)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107060    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007063.2-3454s1c1
Sequence:CCGGCCGAGATTTCAGTCTACCTTACTCGAGTAAGGTAGACTGAAATCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007063.2-2212s1c1
Sequence:CCGGCCTACCCTGTGACTGATATTTCTCGAGAAATATCAGTCACAGGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007063.2-1649s1c1
Sequence:CCGGCGAAACGGGAATTGCTGCTTTCTCGAGAAAGCAGCAATTCCCGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007063.2-2659s1c1
Sequence:CCGGGCTGCCTCGATATTATGTATACTCGAGTATACATAATATCGAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007063.2-3338s1c1
Sequence:CCGGCCAATCACAATCTGAACTTAACTCGAGTTAAGTTCAGATTGTGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018775
VALIDATED
TBC1D8 MISSION shRNA Bacterial Glycerol Stock
TBC1 domain family, member 8 (with GRAM domain)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000088321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018775.1-2259s1c1
Sequence:CCGGGCAAACCCAATGGTGACACAACTCGAGTTGTGTCACCATTGGGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088318    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018775.1-3241s1c1
Sequence:CCGGGCCTTTAATGTTTGTCCTCAACTCGAGTTGAGGACAAACATTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018775.1-2731s1c1
Sequence:CCGGGCTCAATCAGTACAGTCTCAACTCGAGTTGAGACTGTACTGATTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018775.1-1572s1c1
Sequence:CCGGGCAGGTTTCTAGATCACATTACTCGAGTAATGTGATCTAGAAACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018775.1-1983s1c1
Sequence:CCGGCACACCTATTCCAGTTGGTATCTCGAGATACCAACTGGAATAGGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018775
VALIDATED
TBC1D8 MISSION shRNA shRNA Plasmid DNA
TBC1 domain family, member 8 (with GRAM domain)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000088321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018775.1-2259s1c1
Sequence:CCGGGCAAACCCAATGGTGACACAACTCGAGTTGTGTCACCATTGGGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088318    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018775.1-3241s1c1
Sequence:CCGGGCCTTTAATGTTTGTCCTCAACTCGAGTTGAGGACAAACATTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018775.1-2731s1c1
Sequence:CCGGGCTCAATCAGTACAGTCTCAACTCGAGTTGAGACTGTACTGATTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018775.1-1572s1c1
Sequence:CCGGGCAGGTTTCTAGATCACATTACTCGAGTAATGTGATCTAGAAACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018775.1-1983s1c1
Sequence:CCGGCACACCTATTCCAGTTGGTATCTCGAGATACCAACTGGAATAGGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018775
VALIDATED
TBC1D8 MISSION shRNA Lentiviral Transduction Particles
TBC1 domain family, member 8 (with GRAM domain)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000088321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018775.1-2259s1c1
Sequence:CCGGGCAAACCCAATGGTGACACAACTCGAGTTGTGTCACCATTGGGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088318    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018775.1-3241s1c1
Sequence:CCGGGCCTTTAATGTTTGTCCTCAACTCGAGTTGAGGACAAACATTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018775.1-2731s1c1
Sequence:CCGGGCTCAATCAGTACAGTCTCAACTCGAGTTGAGACTGTACTGATTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018775.1-1572s1c1
Sequence:CCGGGCAGGTTTCTAGATCACATTACTCGAGTAATGTGATCTAGAAACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018775.1-1983s1c1
Sequence:CCGGCACACCTATTCCAGTTGGTATCTCGAGATACCAACTGGAATAGGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks